Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name YMR119W-A
Strain S288c
Description Dubious open reading frame unlikely to encode a functional protein, based on available experimental and comparative sequence data
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YMR119W-A	6323767 upstream sequence, from -1000 to -1, size 1000
ATATTGATCCATTTGGTGGAGATTTTCAGGCTTAGAAATTATCGTCTACTTTTTAGTACT
ATTATGAACCTCTGTCATATTTGTTACTTAGGGATAAGAGTTAAGCAGGGCGGCTGGAAA
AGCCTTCCATTTTCGGTGAAATTTAGGCACTTTCCAAAACTGTTTTCAGTGTCTATTATT
TGCTTATCATTACTGATTTTTAAATTATCATGCTTAATTAGATGGGATCCATTTGGAAAA
TCACGTAATTCTTGCGAACTTTTACAGTTTTACCCTCTCAGTAGAAATTGGAAAAAATAC
TTAAATTACACGGGAGAAGAAGATTTTTCTGCTATGGCCACTAAATTCGCACTATTATTA
TGCTCAGGAACTGAACTAATGGAAAAGGGTATACGAAGAGAATTTCCTGCTATTAACATC
CCGGATAATGTTAATGAGAAATTTTTTATTAGCGGTTATTTAAATGAACTTTCTAAACCG
TATAAAGAGAACACTTCCATCAGCTTCCCAAAGAAAAATTCATCAATATTAAAGCAAAGA
TTTTTTTTAATGTTTCCAAAATCTATAATATGGATCATGAAGAAGCTTGTAGGCCAAGTA
TTCTTTGGCTTCAGAGATAACAAGGACGAGGACATCCCCGACAACGACCCATCAAAAATG
TTAAAGATAACTAAAACGAACTCTCTCAATAATAGTGCCGGCCACAAAGAAGATATTGAA
CTTGAACTATTGAACACATCAGATGATGAGTATTCTGAAGATTACGAGCCTTCTGAAGTT
GAGTCACTGGGGGATTCTGATGAAGAAAACTTGGAAGAAGATTCACTGATTTTCAACGAA
ACTCGGGATGCCCTACTGGATTTATTTTCTTCCGAAGATAATGAAGTTCATACTGATTAT
AATTGGATCATGTCAACTAGCCGTATCCTTCAACAAAAATTACTGTCAGATAAAACTTTG
ACAAGGGCGTCTATCTTAGATACAAAGTTAAGTGAAGTAG
Chr coordinates
w3c xhtml validator w3c css validator