Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ADE17
Systematic Name YMR120C
Strain S288c
Description Enzyme of 'de novo' purine biosynthesis containing both 5-aminoimidazole-4-carboxamide ribonucleotide transformylase and inosine monophosphate cyclohydrolase activities, isozyme of Ade16p; ade16 ade17 mutants require adenine and histidine
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ADE17 YMR120C
AAGAGTCAGGGTCTGGGAATACAGACAAAAAAATGTCATTCACAGAGCCGCTAGACCAAC
TAGACCAGACAAGGCTAGGAGACTAGGCTACAAAGCCAAGCAAGGTTTCGTTATCTACCG
TGTCAGGGTTAGACGCGGTAACAGAAAGAGACCTGTTCCAAAGGGTGCTACTTACGGTAA
GCCAACTAACCAAGGTGTCAATGAATTGAAATACCAAAGATCCTTGAGAGCTACCGCTGA
AGAAAGAGTTGGCCGTCGTGCTGCTAACTTGAGAGTCTTGAACTCCTACTGGGTCAACCA
AGACTCTACTTACAAGTACTTCGAAGTTATATTGGTTGATCCTCAACACAAGGCTATCAG
AAGAGATGCTCGGTACAACTGGATCTGCAATCCCGTCCATAAGCATCGTGAAGCTAGAGG
CTTGACTGCCACCGGTAAGAAATCCAGGGGTATCAACAAGGGACACAAATTCAACAACAC
CAAGGCCGGCAGAAGAAAGACCTGGAAAAGACAAAATACTCTGTCGTTATGGAGGTATAG
AAAATGAAATAGTTAGAACCGTATATAGATCAATAATAATGCACTATGAACATTTTTTCA
ACCTGATTACTTCATCGTTCCTTTTCTTCGACTTATTTTTTTTTTATTATTCTTCGCTCT
TTGGCAGCATACGCAATTTGAATTTGCAGTTTTTGACTCTTTTTTCCTTAGCGGAACGAA
CAATATTAATCATGCCAACTAAGTCATTGCAGAAGTCAACTTATCATTTATAAAGAAGAT
CCTACCCTACAATGTGTGTACCCTGATGTGCCCAGAAATGAATTGACTCCTCTCATAACT
TGTTAATATTCGGATGTGCATATCACGTTCGGATCTATGTATATAAATGTACGCTCGTTT
TAACCTTTAGTGTAGTACCTAAAATCTTTCTTACCAGCAACTAATAGCCCTTGAAGTAGT
TTTGCTAGCTTGGACATCAAAGCACATATCACCATCAAAT
Chr coordinates Chr XIII from 509280-507502
w3c xhtml validator w3c css validator