Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL15B
Systematic Name YMR121C
Alias eL15, L13B, L15B, L15e, rp15R, YL10
Strain S288c
Description Ribosomal 60S subunit protein L15B; binds to 5.8 S rRNA; homologous to mammalian ribosomal protein L15, no bacterial homolog; RPL15B has a paralog, RPL15A, that arose from the whole genome duplication; relocalizes from nucleus to nucleolus upon DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL15B YMR121C
AAGCGGAAGCGGAAGTGGAAGTACTGCTGGCCATTTTTATTCAGGTTATTTGCGATTAGG
TTGGGGTTTGTGTTTGATGGAGACCTCAGTAATTAACAGTACATTCTGAGAGCGGCAAAC
AGAATTCTGCCTTAAATTCAGATCGTTTATATACTTTTTTTTCACTTTTTACGCTCGAGA
CACCATAACCCAAAAATAGATCAAACTAGCCATTGTATTTTTCACCAATATGGCAATGTG
ATTTCCGCATTAGGCAATACTGTGAAAGACTCTATGCTACGTCAGTTCGGAGGCGTGTTT
CGCAATCTTCGCGTTCCAGAACGCACCAACGCGTTGTTATTTGCGCAGCACAAGGGGGAC
GAGAGACATTCTGGCCAACGTGCATTCGACGGAAGTAAATTTCGGCTGGAGGCTAAGCGC
TGCTTTACTGCAATTTGCATCATTACGGTGGCTCGCAGGGATAGATTGGGCGTACTGGTT
TGTGGCAAAAACACCGCCTCCACGCTACCTTATTTGCCAGCCAACCGCATATTCAGGTTG
CCAAAGGTACAGATCAGGAAAATGTTTCCCATTGGATGCGCAACTTTCCTTAGTAGGGAA
TATATAATCACTGCATTGCTGGTTTCGTACTGCCATCTTTGCGTTTAAAGTATAACCAAA
TTAATAAAGCGACTACGCCGCTATCCAAAACAGGCTCCTCCAGCTCCTTTAAGGAAACAA
ACGTCTTTTTTCTTTACTCTTATTTTTTGCACCGATTGCTAGAATACTTCTCCAATCTCT
TCAAATGATGATACAAACATGTAGTCAGTAGAGATGTATCTGTCTTGATGCTCCATATGT
CGTTACCCGGAAAACATCTTTCTTGTTCCTTTCGATACTTTTCCACGTTTTCAATTAACC
GGAGCCATTGATAATTTCATTCACTCTTGAGAAGTTAGCGGCAATAGTAATCGGCGAAAG
CTACCGTAAAGACAGTCACAAATTACCTACCACACAAGCA
Chr coordinates Chr XIII from 510348-509734
w3c xhtml validator w3c css validator