Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RIM11
Systematic Name YMR139W
Alias GSK3, MDS1
Strain S288c
Description Protein kinase; required for signal transduction during entry into meiosis; promotes the formation of the Ime1p-Ume6p complex by phosphorylating Ime1p and Ume6p; shares similarity with mammalian glycogen synthase kinase 3-beta; protein abundance increases in response to DNA replication stress; RIM11 has a paralog, MRK1, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RIM11 YMR139W
AAGAGGGAAGCTTAAGGTGTAGAAGAATACATGGGACTACTAAGTATTATCAGGAAACAG
AAGCTCAGGGACAAAGAAATTCGCTGTCTGATTCTAGGACTAGACAATTCGGGGAAGTCA
ACGATAGTAAACAAACTATTGCCCAAGGATGAGCAAAATAACGATGGTATAATGCCTACT
GTGGGTTTTCAAATACATAGTCTGATGATAAAAGATGTGACAATATCTCTATGGGACATT
GGGGGGCAACGCACATTAAGGCCATTTTGGGATAACTATTTTGATAAGACACAAGCGATG
ATATGGTGTATAGATGTGAGCCTTTCAATGCGGTTTGACGAAACCTTGCAAGAACTAAAA
GAATTAATCAATAGAGACGAAAATCGAATAGGATACGAGTGTGCTGTTATCGTTGTGTTG
AACAAGATTGATTTAGTGGAGGACAAGTCCGAGCTTCATCGAAGGTGTTTACTGGTAGAG
AGCGAGTTGAAGTGTCTGTTCAAGCCGGACATCCGAATAGAGCTCGTCAAATGTAGTGGC
GTTACCGGAGAAGGTATTGATAACCTGCGTGACCGTCTGGTGGAATCCTGCCATTTTACC
CAATAATCGTCTAAGATGTGAGCACCATATAAAAACTTTAAATAATGTCAGTATTTATAG
CGTGATAGTTCATTACCCGCCGACTGTGCGCATTCGTGGCTTCTGCTCACTCCGGATAAT
AATACTACCAAGGGGTTCTGTAAGGCTTGCGGGTTACAAAGCACGGGTCCATTGAAGATC
TTACACAAGAAGGAGTGGTAGGAAGACCAGCAGATTATTTCCAATCGGTCGTTGCCATTG
TCTTATTTCCTTTTCTTTCTGGCGCATTGCATTTTAACACCTTTTTTTCCAGAATAGCCA
ACCACCGACGTCTGATTCACACATTACTGGGCAAGATCTTGACATAGCATTACATTACAA
CACGGCAACACTAATCACGCAACGCTAGAACTCGCGCAGG
Chr coordinates Chr XIII from 546125-547237
w3c xhtml validator w3c css validator