Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL13B
Systematic Name YMR142C
Alias eL13, L13B, L13e
Strain S288c
Description Protein component of the large (60S) ribosomal subunit, nearly identical to Rpl13Ap; not essential for viability; has similarity to rat L13 ribosomal protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL13B YMR142C
TGTACAATCGTACTGGTTACGGAACTGACCGTAGTAGTTTAACCAATCTTGTCAAAATAC
TCTCCCCAAAACATTGCCTAATTGGATCTCAATTCGGCTTGTAAAAATAACAATTCTTTC
CTTTGGATAAATACACTATGCGTACTCATTTACTGCCTACTCAGAACTTGGTTGGCTGAC
ATATTCATTTTTTTTCTCTTGATCTCACTCCATTATCGATACTATCAAACATCATTCTGC
AGAACTGAAAACATACTTGAACACTTGGGACAGCTGACATCTTGGGATTCTTCTCTTGTA
TACTTTACTATCTACCTTTATTTATGAGGCTTCCTTTACAGAGTTCAGAATTTGTAGGCT
ATTTTTATGTATATCCTTGCCCTCTCAGTTGTTGCAGCGAGTTCACGATAGTTTGCGCTA
AGCGGTAACTCTTGGAATTCCAGCAAACTGCCAATCGTCCGCTGTGCTAAACTGGACGGG
AGTCAAGGAAAATCAAGCGTCAATTACTTTTCTTACCAGGCCGCCAACAATTTTTATATA
CGGCCTTAGCATTTTCCATTTCCGAGATGATTTTATAATGTATGGGTGCCAATATGTACT
GATGTTTAAGTAATACGGTGAGATTATCTTGAAAAAGATTTTCAGTGCCATAAAATCTGT
ACATTACGCACCCATACATTTATAGTTTTTAAAAAAATACTGTATCATCCCGGACGCACG
TTCGCGAGTGTAATCTTTTGCCTTGCGTAGGCTTCCATCTCATCCACTGGCCTCGCTAGA
GGAATCTCTAGTGGGGTCATTCGACTTCTTGGTACGCTCTCCTCAGGCTGACGCGGCATT
GCAAGGACACATTACTAACCTACTCGGAGCCGGTGCTCACCATCCTCCATTGGGAAGTTA
CTTTCTTACATACTATGTAATTAGAGGTACTTGAAGTTAGAACATAATGTAACATTAATA
GGAAATAATTTCGGAAAAGTAAAGCAGGAATCAAGTAACA
Chr coordinates Chr XIII from 550801-550206,551207-551204
w3c xhtml validator w3c css validator