Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NDE1
Systematic Name YMR145C
Alias NDH1
Strain S288c
Description Mitochondrial external NADH dehydrogenase, a type II NAD(P)H:quinone oxidoreductase that catalyzes the oxidation of cytosolic NADH; Nde1p and Nde2p provide cytosolic NADH to the mitochondrial respiratory chain
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>NDE1 YMR145C
ATGATTAGACAATCATTAATGAAAACAGTGTGGGCTAACTCCTCCAGGTTTAGCCTACAG
AGCAAGTCGGGGCTTGTGAAATATGCCAAAAATAGATCGTTCCATGCAGCAAGAAATTTG
CTAGAGGACAAGAAAGTCATTTTGCAAAAAGTGGCGCCCACTACTGGCGTTGTTGCGAAG
CAGTCCTTTTTCAAGAGAACTGGGAAATTTACTTTGAAGGCTTTATTGTATTCTGCCCTC
GCGGGTACGGCTTACGTTTCATACTCACTTTACCGAGAAGCTAACCCTTCTACCCAAGTT
CCTCAATCGGACACTTTTCCAAACGGTTCAAAGAGGAAGACTTTGGTAATTCTGGGCTCC
GGTTGGGGTTCTGTGTCGCTTTTGAAAAATTTGGACACCACGTTGTATAATGTTGTTGTT
GTTTCTCCAAGAAATTATTTTCTTTTTACTCCGCTATTGCCATCTACCCCAGTTGGTACC
ATCGAATTGAAATCTATTGTTGAACCTGTCAGGACTATTGCTAGAAGATCGCACGGTGAA
GTCCATTACTATGAAGCTGAAGCGTACGACGTTGATCCTGAAAACAAAACAATTAAGGTC
AAATCTTCCGCTAAGAATAACGACTACGACTTGGACTTGAAATACGACTATCTGGTTGTC
GGTGTGGGTGCTCAACCAAACACTTTTGGTACTCCGGGAGTTTATGAATATTCTTCTTTC
TTGAAGGAAATATCCGACGCTCAAGAGATCAGATTAAAAATTATGTCCAGTATTGAGAAA
GCTGCCTCCCTATCTCCAAAAGATCCTGAGAGAGCAAGATTGTTGAGCTTTGTTGTCGTT
GGTGGTGGTCCCACCGGTGTCGAATTTGCCGCTGAATTGAGAGATTATGTTGACCAGGAC
TTGAGAAAATGGATGCCCGAATTGAGTAAAGAAATTAAAGTCACTTTGGTGGAGGCTTTG
CCAAACATTTTGAACATGTTTGACAAGTATCTCGTTGACTATGCTCAAGATTTATTCAAA
GAGGAAAAAATCGATTTAAGATTGAAAACAATGGTTAAGAAAGTTGACGCTACCACTATA
ACTGCCAAAACTGGCGATGGTGACATTGAAAATATACCGTATGGTGTATTAGTTTGGGCT
ACAGGTAATGCGCCAAGAGAAGTGTCTAAGAACCTAATGACTAAATTAGAGGAACAGGAC
TCAAGACGTGGTTTGTTGATAGATAACAAACTTCAACTTTTGGGTGCTAAGGGATCTATT
TTTGCTATCGGCGATTGTACCTTCCACCCTGGCTTGTTCCCTACCGCTCAAGTTGCCCAC
CAAGAAGGTGAATACTTGGCTCAGTATTTCAAGAAAGCTTATAAAATCGATCAATTGAAC
TGGAAAATGACCCATGCTAAAGACGATTCAGAAGTCGCTAGATTAAAGAACCAAATAGTC
AAAACGCAATCGCAAATTGAAGACTTCAAGTACAACCATAAGGGTGCTCTGGCTTATATT
GGTTCAGATAAAGCCATTGCTGATCTTGCCGTTGGTGAAGCCAAATATAGGTTAGCCGGC
TCATTCACCTTCCTATTCTGGAAATCTGCTTATTTGGCAATGTGTCTATCCTTTAGAAAC
AGAGTTCTTGTCGCTATGGATTGGGCTAAAGTTTATTTCTTGGGTAGAGATTCATCTATC
TAG
Promoter Sequence
Download FASTA
>NDE1 YMR145C
ATTTTGATGCTGATGTTGATGTATAGTAAACATACATATATGCATATACGCACGTATATA
TATATAAGAATATGAAACCCAAACTGTGGATATTATTTCGTTTATTATGATCTCTCGCAT
ATCTTGATACGAAGTGCAAGTCATTATAATATTTAGACTTTTCATTACGTTAATAGAGAG
TCACTTTAACCACGAGGGGAAAAAACACATACCCCTCCCCTTCGAGGTAATCTTCCGGTG
AGATCTTCCCTGTATGCAGTTCCCGGGCATAGGCGGGTTTAACATCTTGCTAAAGAACTA
TCGCACTAACCCTCTGGTACCCAATGCCGAGATTCGGTAATGGGGGCACGGCACTACGGA
AAAAAAACTACAATTCTAACTCTACCCCGCCCCTTACGAAAACGCCCTAGCTCAACCATT
CCGACCGATAAAAAGTTGCCGCGATCCCGTCGATCGCATTTGGTTTTGAGGTAAAAAAAG
AAAGCGACAGGGATCTTCTCCACGATGCTCGAGATGCCCTGGTCCTCGCTATGGCATTAC
TCTGGCCTCAGCGGTATTTGCATTCACAACCATCACCATCGGGATGGTAATACATGGCTC
GGCAATGAGAAGAGTTTTGGCACACATGGGCCACTCCTTATGCTTTCTTTCCGTTGTCTC
GAAGCGTGTGGTGTTTCTATTTTCATTCTCCTTCTTGGGTGTATATATAAAAGAGGTTGT
GTTATATAAGACAACGCTCATTGGCCTGTTCTTGATTTTGATTTTTTCCGCTTTTGTGCT
GTTGGGGCTAGAACTATAAGTGTGTCGATTGTTTTTATCTTCATTATTTCTTTTGCATGT
TTAGTATTTAGACTAAATTTATACGCAGCTACTATCTTTTATTATATATTCTGGTAAACC
AATTAAAGAGAGAAAAAGGAAAAAAATTTTCACACTAATATTCTTCATATAGCATCATAA
TATTGACTTATTAGAGCAAATAAAAAATTAACCAATAATA
Chr coordinates Chr XIII from 556475-554793
w3c xhtml validator w3c css validator