Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IMP1
Systematic Name YMR150C
Alias PET-TS2858
Strain S288c
Description Catalytic subunit of the mitochondrial inner membrane peptidase complex, required for maturation of mitochondrial proteins of the intermembrane space; complex contains Imp1p and Imp2p (both catalytic subunits), and Som1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IMP1 YMR150C
CAGCAGCATATACAAAGTCGTCATATGGGTCATTTTCGTCCTTTGGAACCTCCACCATAT
GTGTGATGGGTACATCTTTGGCAGGGTTGAGTATCAAGTAGTGTGTTAAAGTACCACGTT
CACCATAAATATGACTGTACATACCATTCACTTTGTCGCCAACCTTCCAGCGATTGTCGA
CATCCTTTCCCGCTTTAATGATGACACCACTGTAATCTCTAGAATAAGTCTTTGGATACT
TGCCAAATATGTAGGAGTTACAAAGCTGGTGAGTAATAAAATCAATTGGATTCAAAGCAG
CAGCATGGACTTCTATAACAACTTCGTCATCTTGATAACATGATCTCAAGTCCAGCTCCG
ATGATGTAATTGTGACTGGAGTAGTATTGTTAACATAAGTAACAGATTTGTTGGTTACAA
TCTCGTCTGACATAGTTTTAAAGTATTACCTTTTGTTGTTCGATAATAGAAACGCCGAAA
TATTTTAGTTTTACTCCATTCAAATAAAGGCCAGTCATTTTTTTATGTATTAAAAGGAGG
ACAGTATTTTTGCCCCCCTCAACTTTAGAGGGCACTGAAAGGATTTTACAGCAGGAATCC
TCTTAAGAAAATCGTCGCCGACAGTACACAGGAAAAAGAAGAGTAAATAATGATTTCTGC
ATATAATAGCATAATCATGTAATTTTTACTGCATAAATTACACAGTAGGTCGTTTATTTG
TCTGTTGATCTTATGTCGTGAGCCCAGTTGATAAATTAAGAGTAGGGTGTTAAATTTACT
GCAACCTATCTTCTCTTGAATATGGACTTGATATATTCTGAGCTTTTCTTTGAATATTCT
CTTCTGTTGGTTTGAACCGCACAGCAAATTTATAACACTCTGACAATCTAAGTATTTCTG
GGGAAAAAACATTCCTTCAATAAAAATGCTCCAGTATATTATTGCAAACAAAAACGGACC
AATAAGACAGTGAATCATCCAACAGTGTACAATACCAGGG
Chr coordinates Chr XIII from 562528-561956
w3c xhtml validator w3c css validator