Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IMP1
Systematic Name YMR150C
Alias PET-TS2858
Strain S288c
Description Catalytic subunit of mitochondrial inner membrane peptidase complex; required for maturation of mitochondrial proteins of the intermembrane space; complex contains two catalytic subunits (Imp1p and Imp2p that differ in substrate specificty) and Som1p
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>IMP1 YMR150C
ATGACGGTTGGTACACTTCCCATCTGGTCAAAAACCTTTTCTTATGCAATTAGGTCATTA
TGCTTCTTGCATATAATACATATGTATGCATACGAATTTACTGAGACGAGGGGAGAATCA
ATGTTGCCAACACTGTCAGCGACCAATGATTATGTGCATGTCTTGAAAAATTTCCAAAAT
GGTAGAGGCATAAAAATGGGTGACTGCATAGTAGCACTGAAACCTACTGACCCTAATCAT
AGGATTTGCAAAAGGGTTACGGGTATGCCTGGTGATCTCGTGCTCGTGGATCCCAGTACG
ATAGTTAATTATGTCGGCGATGTGCTTGTTGATGAGGAGAGGTTTGGTACCTATATTAAA
GTCCCTGAAGGTCATGTTTGGGTAACCGGAGATAATTTGTCACATTCATTAGATTCAAGA
ACATACAATGCATTACCCATGGGGCTGATCATGGGCAAGATTGTAGCTGCTAACAATTTT
GACAAGCCCTTCTGGGACGGTTCGATACGCAATATTTGGGGTTTCAAATGGATCAATAAT
ACATTTCTAGATGTGCAGGCTAAGAGCAACTGA
Promoter Sequence
Download FASTA
>IMP1 YMR150C
CAGCAGCATATACAAAGTCGTCATATGGGTCATTTTCGTCCTTTGGAACCTCCACCATAT
GTGTGATGGGTACATCTTTGGCAGGGTTGAGTATCAAGTAGTGTGTTAAAGTACCACGTT
CACCATAAATATGACTGTACATACCATTCACTTTGTCGCCAACCTTCCAGCGATTGTCGA
CATCCTTTCCCGCTTTAATGATGACACCACTGTAATCTCTAGAATAAGTCTTTGGATACT
TGCCAAATATGTAGGAGTTACAAAGCTGGTGAGTAATAAAATCAATTGGATTCAAAGCAG
CAGCATGGACTTCTATAACAACTTCGTCATCTTGATAACATGATCTCAAGTCCAGCTCCG
ATGATGTAATTGTGACTGGAGTAGTATTGTTAACATAAGTAACAGATTTGTTGGTTACAA
TCTCGTCTGACATAGTTTTAAAGTATTACCTTTTGTTGTTCGATAATAGAAACGCCGAAA
TATTTTAGTTTTACTCCATTCAAATAAAGGCCAGTCATTTTTTTATGTATTAAAAGGAGG
ACAGTATTTTTGCCCCCCTCAACTTTAGAGGGCACTGAAAGGATTTTACAGCAGGAATCC
TCTTAAGAAAATCGTCGCCGACAGTACACAGGAAAAAGAAGAGTAAATAATGATTTCTGC
ATATAATAGCATAATCATGTAATTTTTACTGCATAAATTACACAGTAGGTCGTTTATTTG
TCTGTTGATCTTATGTCGTGAGCCCAGTTGATAAATTAAGAGTAGGGTGTTAAATTTACT
GCAACCTATCTTCTCTTGAATATGGACTTGATATATTCTGAGCTTTTCTTTGAATATTCT
CTTCTGTTGGTTTGAACCGCACAGCAAATTTATAACACTCTGACAATCTAAGTATTTCTG
GGGAAAAAACATTCCTTCAATAAAAATGCTCCAGTATATTATTGCAAACAAAAACGGACC
AATAAGACAGTGAATCATCCAACAGTGTACAATACCAGGG
Chr coordinates Chr XIII from 562528-561956
w3c xhtml validator w3c css validator