Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TPP1
Systematic Name YMR156C
Strain S288c
Description DNA 3'-phosphatase; functions in repair of endogenous damage of double-stranded DNA, activity is specific for removal of 3' phosphates at strand breaks; similar to the l-2-haloacid dehalogenase superfamily; homolog of human polynucleotide kinase/3'-phosphatase
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>TPP1 YMR156C
ATGTCCCACAAATTAACAATCCTGCCATTTCTGATTAAGTTCACGCCCAAGTTTCCACAA
TCCATTGATCACGACGAGCATGGTCTAAACGTTTATGCCTTTGATCTGGACCATACAATT
ATCAAACCAAAGTCCCCCAATATAAGTTTTAGTAGAAGCGCAAGTGATTGGCAGTTTATT
AATTTTAACTCCAAGAAATCCACCCTGGATTACCTGTGTAATATCATTGATAATGATCCC
ACGGCCGTCATAGTCATATTTTCTAACCAAGGTGGTGTCATCACCGTCCCAAGAACTTCT
AAAAGTTGCACCAAGTACACTAATAAAATTTTGCTATTTTTAAAGGCAATCAAAAACGAT
GAGAGAGGAGAAACGTTATCACACAGGTTATGGCTATATGCAGCACCTAAAAGGCCGAAA
ACTTTTGCAGCAAATCATAGTAAGATCACATTCGCAAGCTTAGGTGAAAGTTATAACAAT
GATCCTAACATATTCGAAAAAGTTCGAAAACCAATGACAGGAATGGTAGAGTTTTTTAAA
AGGGACCTGGAAAGTGCATACAGGGTTTCAGAACAAATTTCTCCCATCAAGTTGAATTGG
ATATATTATTGCGGTGACGCTGCTGGGAGGAAAAAGGACTTCAGTGATTCTGACATAAAG
TTTGCTGAAAACTTGCACGTTGAATTCAAGTACCCTGAGGAAATATTTCACGGGTAG
Promoter Sequence
Download FASTA
>TPP1 YMR156C
TAGCAAGCTGCCGACATTGTTTCAAGGTGTGCGGTGGGTTGCCTCAAAAGCAATTACCCT
TATTTTCACCATTGCTCTTGAGAGCACGATACTCATCAACTGATAGCTCAACTAAAAGGT
CTAACAAATCAGATAAAATAGATGCTCCAGGATTTAAGAAAATTTTCCTTGTTGCTATTA
TCGGTACAGTGATATTTGTCAAGACAGTACAGTCTTTAGATAAGAACAAACCGAAGACAA
CATTATCAGAAGAAGAATTCGAAAATGTGGTTAAAGGGTTGAAAAGACGTGTGGCTATCT
TCCCACAAGGTGAGGTCGATATAAAGTTTTCCTTATCACCCAGCATTGAAGAAACTAGAA
AGGTACTGCAGAAATCACAAGGCGATGATATAAATGAGCTGCAGTTTGTCGATCCAGTCA
AGGTCATCGATTACTACAGAACCTTGAGGGATGATAGATATGAGGCTTTATTAAATGAAT
ACTACAAAAAATACGGGTGTGACACGTACGCTTACAATTTGCCGACCGGTATGTTGGTCA
TGCTTTTGGGTAGATATTTCAAAGAGAACTTCAAGACCGGTGACAAGCTAGTAGTTGTGA
ACTTTCCTCATTCGATTGCTGATGCAACAAGATTTGAAAATGAGGTTTCTATAGTGTCTA
AAATCTTTGTTCCGAGGAAATTGAGTGGCTCTGACGTCTGTAAATATTACGAAACTGTAG
GTAAAGCTGATATCATCTGAGGATGTTTTCTTTTTTTTTTTTTTTTGGTTTCTTCTCCTT
GTTAATAGCTTATATGTATATATATCTGGATATATGTCCTGAATATGCTGCTTATCTGTC
ATATAACATTCTCATTTTCTGTTCCCTTCATCTATGTGAATGAATTCTGTGCGTTTCTTT
CGTTTCCCCTCTTTTGCGTATGGCTTTAAATCGATTTTAATCTGTAAAATCATCCCAAAA
TCAGATGGATAACATAGAAAACTGAACCGAAGGAAAGCCC
Chr coordinates Chr XIII from 571016-570300
w3c xhtml validator w3c css validator