Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DNF3
Systematic Name YMR162C
Strain S288c
Description Trans-golgi network aminophospholipid translocase (flippase); type 4 P-type ATPase; involved in phospholipid translocation, contributing to the maintenance of membrane lipid asymmetry in post-Golgi secretory vesicles; role in protein trafficking between the Golgi and endosomal system; localizes to the trans-Golgi network; localizes to the shmoo tip where it has a redundant role in the cellular response to mating pheromone
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DNF3 YMR162C
ATAACAGAGAATGATAGGAACATCATTGAGGATAAGTTGGAGGAGCTCATTACTTTCTGG
AAAACCTCGAAAATTTGTGGCAATATTTCTAGGATACAAAAGGTATCCCCAACCAATACA
ATCAACCATGGTTTCCATCTGGATATCCTCAAAGGCAGAAAGTCACCCCGTTCTTCGTCA
GTACAAGGTCTTAGCTTAGAGAGGAAAGTTGACTTCATTGATGTTGCTGAATCGGTGAAT
GACTCTTTTGAAAACGACACCGAACTAGAGGAATATGAAGACTACGACTGTCAGGAGGAA
TGTTCTGCCGGTTCACGCCAAAATCACCGCGTAGATTTTATCGGAAAGGATAGTTGTAGG
AAACCAGATTTCAAGCAACTTTCTGACAACGAATTACGACGCAAGTTAGATGAAAGAATT
TTGAAATTGGCTCAAGAAAACCGTGAAGGCAGGGAAAGGCTAAGAACTGCAAAGTCCTTT
GAATTGCTAAGAAAAGCTCAGGCTTCCATGTCCGTAAAGTTTGGCTTTCAAAAACCATTA
AGAGACGATGCCTTTCTTGAGAGCAGGCCTCTCAGCAAATGCAAAGTATCTTCGGAAGAA
ACTATCCCATTTTTGTATGAATTAAAAGGATTACTAGGAAATGATTCATGATAATATATT
TTAATATGTACTTTGAAATAACTAATTACACTTTAATCATATTTTCTAAATAAGCAAATG
ACGGGCTGCGCAGCCGGGTTATTTTCGACCCCAGTCTGTCAAGTGCTTTAAGTAAGCGAA
TATTTAACAAAGAAGAATTCAATATTGCAGGAAGTCTTGAGAAAAGATCAAGTGCCAAAT
TACCCCATTGCTTTTGGACTATTCATTCACTCTTTTCTTTTTTGTTATTTCTTTTATTTG
ACCTTTATCGTTATATACACATAGCTTCCATACAGCAAATAAACATCCTAATTGAAGTAG
ATAATTTAATTCCATTCTTTATTAAAAAGAAAAAAATATT
Chr coordinates Chr XIII from 583921-578951
w3c xhtml validator w3c css validator