Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DDR48
Systematic Name YMR173W
Alias FSP
Strain S288c
Description DNA damage-responsive protein, expression is increased in response to heat-shock stress or treatments that produce DNA lesions; contains multiple repeats of the amino acid sequence NNNDSYGS
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DDR48 YMR173W
AAATCGAAACAGATATGAAGAACGCTTCGATTAACAAGCGGAGGAGGAGCTTGCATCATA
AAAAAAGTAACTCTTTAAACGGTAGAAGAAAGCTTCACGGCGAGTCGGCTACTAAGCCCA
ACATAAACTCTGATTTACATTATAGGATATTGAAGGCTCCCACTGACGTAAAGACTATAT
GGGAAGAGTATGATACTGGAATAAGAGGAAAGCCATCGATCAAGCATCTTGAGGCCAAGT
ATGGTAACAAGTGGAGGCTCAATAAAAATAAGAAGACCTTTTCAAGGCGAAAAAGATTGT
ACAAGTTCATTCTGAACGGTATGGAGAGAGGTAAAACGGCACAAGAGATGATAGAAACCT
TAGAGAACAAAAGGCTATATAAAGATGATGAGGATGGCGAAGTAAAGAAAAGAACCATTG
GCTGGTTGCAAGAGAGCCTTGCTGGAATATAGGCACGTACGATAGTAAATAATCGTTTAC
AATCATAGGAAGGAAGGAAAAAACAAGTGTAACATAAATACATTCTGTAAATCTACAAAA
ATCGTTAGTGCTGTTTTCTTTTTGAGATTGAAAAGTACGAATCATACACATCTCTTATTC
TGAGAAGGGTGCATATGACGTAAATCAATGCGTACAAAGCGGTTTCCGGTGCTGGCCTGG
CCCACCACAGTTTTGGCGTGGTTGATTTTAAAAACCTTCGGGAAGGTGAAAAAACCACTC
CGAAGGTTCGAGGATGACAAATCGCCCCTTAGCTGTGGCCATACAAGCTTGGCACCGACG
AAAAAGGGAAAAAGGAAAAGAATGTCGTACAAGAACTCTTACAACCACGTTGAGATTTCA
TTTAACAACGCCCCCCTTTCCATTATATAAGAAGGCATTAATTTTTATGTAATAAAAAAA
GAATTTCTCGAAAATGTCTTACAATTAATTTTTTCTTTTGTAGAGTAGGGCTTTAATAGA
CTGATATATACGGTATTATAAGTGAACGAAAAAAACAGCA
Chr coordinates Chr XIII from 608689-609981
w3c xhtml validator w3c css validator