Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SIP18
Systematic Name YMR175W
Strain S288c
Description Phospholipid-binding hydrophilin with a role in dessication resistance; expression is induced by osmotic stress
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SIP18 YMR175W
TTGTGTTTAGACTTAAGTATGAAAATTTTATGTATGAGCTGTGGCTATGTATCCGCTGGC
AAATAGGTCTGCTTTTTCTACACTTTCCACCCTCAACCTAACAGAGCCCGCTGGCACAAA
TAATCGATAGTAGGACAACAGAGCTACTCCTTCTTATGCCCCGCCCCTTTGAGCTTGTTG
TATTGCTCTTGATAGTTGTGTTTTTCACTTTCATCAGCATCGGTAGTCTTGCCGTCCTTG
TCTTGACTAGCCATTTTCTTAAAAGCGTCACTCACTACCTTTGCATCGCCCTGCAATTTT
TCCTTTGAGCTCTGAAATATTTCGCTCACTTTTTGTTGGTCTGTATTCATTCTGGATGTC
TTGGTTGTAGAAATTTCTTTTATTGGTTCATTAAAGTCAAGGTAAATGGCGAGAACTAGA
ATAGAGTTTTATTCTTTTTACCGTTATATAGATAATTCTAGCCGGGGGCGGTCGCCCCTG
AGATTCCCGACATCAGTAAGACATAGTACTGTACGATTACTGTACGATTAATCTATCCAC
TTCAGATGTTCAACAATTCCTTTTGGCATTACGTATTAATACTTCATAGGATCGGCACCC
TCCCTTAAGCCTCCCCTAAATGCTTTCGGTACCCCTTTAAGACAACTATCTCTTAACCTT
CTGTATTTACTTGCATGTTACGTTGAGTCTCATTGGAGGTTTGCATCATATGTTTAGGTT
TTTTTGGAAACGTGGACGGCTCATAGTGATTGGTAAATGGGAGTTACGAATAAACGTATC
TTAAAGGGAGCGGTATGTAAAATGGATAGATGATCATGAATACAGTACGAGGTGTAAAGA
ATGATGGGACTGAGAGGGCAATTATCATCCCTCAGAATCAACATCACAAACATATATAAA
GCTCCCAATTCTGCCCCAAAGTTTTGTCCCTAGGCATTTTTAATCTTTGTATCTGTGCTC
TTTACTTTAGTAGAAAGGTATATAAAAAAGTATAGTCAAG
Chr coordinates Chr XIII from 611016-611255
w3c xhtml validator w3c css validator