Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ECM5
Systematic Name YMR176W
Strain S288c
Description Non-essential protein of unknown function, contains ATP/GTP-binding site motif A; null mutant exhibits cellular volume up to four times greater than wild-type, also large drooping buds with elongated necks
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ECM5 YMR176W
TGGAAACGTGGACGGCTCATAGTGATTGGTAAATGGGAGTTACGAATAAACGTATCTTAA
AGGGAGCGGTATGTAAAATGGATAGATGATCATGAATACAGTACGAGGTGTAAAGAATGA
TGGGACTGAGAGGGCAATTATCATCCCTCAGAATCAACATCACAAACATATATAAAGCTC
CCAATTCTGCCCCAAAGTTTTGTCCCTAGGCATTTTTAATCTTTGTATCTGTGCTCTTTA
CTTTAGTAGAAAGGTATATAAAAAAGTATAGTCAAGATGTCTAACATGATGAATAAGTTC
GCTGAAAAATTACAAGGTAACGATGATTCCCATCAGAAGGGAAAGAACGCCAAATCCTCC
AACAAGGAAAGGGATGATATGAACATGGACATGGGTATGGGTCATGATCAGTCCGAAGGG
GGAATGAAGATGGGCCATGATCAATCTGGAACAAAGATGAACGCTGGCAGAGGAATTGCG
AACGATTGGAAGACTTACGAAAACATGAAAAAATAATGTTACGTTTTTTTGGGCGCAATT
AACCAAGTCCTTTTATTTTTTTAATGGTTTATTTATGAATTGTTTATGTTTATGTTCTTT
ATACTCAAAATCAATAAGTGCTTATTTTAGCGAATTTTCTTCTACGAATATATATAAGTC
ATATCTAAGACTTCCATCCGTGCTTTATTACGTTTGTATGATGCATACAATGATGCCAAA
TCAGCTTGATGCTGTTGGTATTCAGTCGTCCGAAAGCCTGTTGATGTGACACTCAAATCT
TCGGCATGTGTGAACGGTGGCCGAGCATAGTTCGTGAACATCATCACTTAAAATAAGAAC
TACACTTTACATCAGCGTGGAAGATAAAGGTTGTTTTAAGCTCAAGGGCGCTGGAGGTGT
AGCGCTTCGGAGGAAAATAATATTGAATAACTTCGCTTTTTGTTCCAAATTCTAGATTAT
CGTGTATGTTCTTGTTCGTACGTCCATCTCCATAGTTATA
Chr coordinates Chr XIII from 611740-615975
w3c xhtml validator w3c css validator