Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YMR181C
Systematic Name YMR181C
Strain S288c
Description Protein of unknown function; mRNA transcribed as part of a bicistronic transcript with a predicted transcriptional repressor RGM1/YMR182C; mRNA is destroyed by nonsense-mediated decay (NMD); not an essential gene; YMR181C has a paralog, YPL229W, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YMR181C YMR181C
AGTTTCAATAGGACCGAACATTTGGCTAGACATATCAGGAAACACACAGGGGAGAAACCA
TTCCAATGCAATATCTGCCTTAAATTCTTCAGTAGAATCGATAACTTAAGACAACATCAA
TCTTCTGTTCATTCGGACGTTGATTTGATGTCCTTACGTAGACTGCAGCAGTCCGCAAAT
AGCACTGCGAACGACCCTAACGCAACAAGAATGTTCCCGCAATTACGCCCATATGGAATT
GTTGTCCAGCCCGCGCCTGTTCCATACAATCTGCCCATATCAACTCCTGCTAGCCCACAA
GACACTATATCTCTTTACGCACCACCATACTTCCCTCATCCTATGCCATCTGCTCCCATA
CCATTGCCGCATCAGCCTCCTCCACTACCAATATACAGCTATATGCAACCACTCTTCCTG
AACCACACTCCCATACAAAACCACAACATTGTAGAGCTCCCTCCAGATAGCAGTGACACT
CCAGCATCGCCGTCTAAGGTGCAAAGTTTTGACCAGGCCAAGGACGCTTCACCAAACGCA
AAAAAATAAGCTCTACCGCACCCACTCCTCCATTTCACAAGCCGCATCATTGCTGCTATT
GTACCCTCTTGGCCATTCGCGTGCGCGTTGATTGCCGTTATTATGCAGATATTTTGATAT
CGCTTGCCGTTTGGCTCATCTCCGCGCCCTTAAAATATATCCGCTTCTGTTGGGAAATGC
CGAGCATAAAAATGCCGAAAATATAAAAAGAACAAGAACAATACCCTTCGAGGGAAACGC
TATTTTCCTGTCCACACAACCTTAATTAATTCGCACGTCTGTGCCACCAAGTAGCAACTG
GTTCGTATTGCTTTATCTTTCTTGCTTGTTATTACATTGCTGTAAGATAACAAGCAGCGT
TTTACTCTACGGATTGTTTATAAGGATTTTGTTCCTCGACCCCTTATATTTACTCACCTT
CCCCCTACTCTAATTCTCCTGATTTCAGAACAAAAAAAAA
Chr coordinates Chr XIII from 624080-623616
w3c xhtml validator w3c css validator