Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YMR181C
Systematic Name YMR181C
Strain S288c
Description Protein of unknown function; mRNA transcribed as part of a bicistronic transcript with a predicted transcriptional repressor RGM1/YMR182C; mRNA is destroyed by nonsense-mediated decay (NMD); YMR181C is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YMR181C YMR181C
AGTTTCAATAGGACCGAACATTTGGCTAGACATATCAGGAAACACACAGGGGAGAAACCA
TTCCAATGCAATATCTGCCTTAAATTCTTCAGTAGAATCGATAACTTAAGACAACATCAA
TCTTCTGTTCATTCGGACGTTGATTTGATGTCCTTACGTAGACTGCAGCAGTCCGCAAAT
AGCACTGCGAACGACCCTAACGCAACAAGAATGTTCCCGCAATTACGCCCATATGGAATT
GTTGTCCAGCCCGCGCCTGTTCCATACAATCTGCCCATATCAACTCCTGCTAGCCCACAA
GACACTATATCTCTTTACGCACCACCATACTTCCCTCATCCTATGCCATCTGCTCCCATA
CCATTGCCGCATCAGCCTCCTCCACTACCAATATACAGCTATATGCAACCACTCTTCCTG
AACCACACTCCCATACAAAACCACAACATTGTAGAGCTCCCTCCAGATAGCAGTGACACT
CCAGCATCGCCGTCTAAGGTGCAAAGTTTTGACCAGGCCAAGGACGCTTCACCAAACGCA
AAAAAATAAGCTCTACCGCACCCACTCCTCCATTTCACAAGCCGCATCATTGCTGCTATT
GTACCCTCTTGGCCATTCGCGTGCGCGTTGATTGCCGTTATTATGCAGATATTTTGATAT
CGCTTGCCGTTTGGCTCATCTCCGCGCCCTTAAAATATATCCGCTTCTGTTGGGAAATGC
CGAGCATAAAAATGCCGAAAATATAAAAAGAACAAGAACAATACCCTTCGAGGGAAACGC
TATTTTCCTGTCCACACAACCTTAATTAATTCGCACGTCTGTGCCACCAAGTAGCAACTG
GTTCGTATTGCTTTATCTTTCTTGCTTGTTATTACATTGCTGTAAGATAACAAGCAGCGT
TTTACTCTACGGATTGTTTATAAGGATTTTGTTCCTCGACCCCTTATATTTACTCACCTT
CCCCCTACTCTAATTCTCCTGATTTCAGAACAAAAAAAAA
Chr coordinates Chr XIII from 624080-623616
w3c xhtml validator w3c css validator