Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GCV2
Systematic Name YMR189W
Alias GSD2
Strain S288c
Description P subunit of the mitochondrial glycine decarboxylase complex, required for the catabolism of glycine to 5,10-methylene-THF; expression is regulated by levels of 5,10-methylene-THF in the cytoplasm
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GCV2 YMR189W
TGTCTAACTGTAAAAGTTGCCTCACTGTTTCTTGTGAAAAATCTTGAATGCCGTACCTTT
GTTTAATCTCCAATAACTCTTTCGGCGTTGACCCGCTAGATAAAGCATCTTGGATGGTCC
TAATATCACGTAAAAGGGTTGTTTTTTCATTTAGTTTATTCTCCCTCACTGATCTTTTAT
CCAAAAATTCTTTTGCCTTTTGGGCTTCTTCTTTTGCAACGCTTAACTGAGCTTCTGATT
CGTATAATGCAAATTGTTGACCCTTGTTTCTAATAATTTCTGCAATGGCAAAAAACTTCC
TCTTTGAAAGCGGCCTCGTCGCTTCTATCCTTACTAAATCACCCTCCCTTGATATTTCAC
CTTCATCATGCACTAAATAATCTCTTCTATGAAATAACTCCTTGTTGATTTTCTTATTAA
AGACTTTTGTTTCTACACGTACTTTAACCGTCTTTTGCATCTTCCCTTGGGAGACGACCA
AGCCTAAAAAATTTTGGCGAGCCATTACAGTTTAACTGATCTTGATTTGACTTTTGAAAT
CTCTAACCCGAATTCAACTCCCTGAGTTTACTTCTGTTTGGCCTTATTTGTGGATTTCCT
CTAACAGTTTGATGCTCGCATTGGTTTGGCACAATCCCAAATTGCTTCAGAATTCTAATC
TTATGAAATAACAATCATGTTACCCGGTTGAATCGTTACCCGACATCTCTGACTCTTCTT
GAGGTATAGACTCCTCCTTTTCGGAGTCATGACTCTCAGAGGAGTCATCGAAGTCAGCAT
TGAGCTGTGAAGGACCTTGATAAGCTAGTCGAAAGATCTCCAACGAATATAAATGGATGT
ATATATAGCAGGCTCGAGTGGCACAATTTTCTTCTCTTCAAGTTCCAGTGAATTAGTCTT
TCTCGTGTGTACCAATCTTACTGTATTGATTGCTGCGCGATCTAACCATCAACTAACCAC
AGTTTATTGGAAAAACGTTTCCTAATACCAGGAAGATAAC
Chr coordinates Chr XIII from 637500-640604
w3c xhtml validator w3c css validator