Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CLN1
Systematic Name YMR199W
Strain S288c
Description G1 cyclin involved in regulation of the cell cycle; activates Cdc28p kinase to promote the G1 to S phase transition; late G1 specific expression depends on transcription factor complexes, MBF (Swi6p-Mbp1p) and SBF (Swi6p-Swi4p); CLN1 has a paralog, CLN2, that arose from the whole genome duplication; cell cycle arrest phenotype of the cln1 cln2 cln3 triple null mutant is complemented by any of human cyclins CCNA2, CCNB1, CCNC, CCND1, or CCNE1
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CLN1 YMR199W
GAATGTTACGGGACTAACAGGCGGATGTAAATTACTCACTTAAACGCAGCCAAACATCAT
CGAGAACTTAGGGTAGCGTGCCACAAAATTTGCATGAATAAACTTTTGTTTTCCTAATTC
GACAGCATTCCCTTGTTCGCAACACTTCACTGATAGGAAATCGAATAGCGCACACTCTCT
TCTGGGACATACCCCAATGCGGTAAAGCCACGAAAACACCGCGCGTAAAGGGGTAAACAA
GTCCATTCCTACAACCTCTTGGAGAAATTCTTTACCTACTACAACCCCGCGCCTGATACT
TTCAGTATTCATGACAACTCGAGCCAGATCCCGCTCGTGGGCGTGTTCATTCTGTGACGA
TCCACTAGCGACTTCTTTGTTCAGCCTGCAAGAGACGCGTTCAAGGAAGAATTCGCGATT
TTACTTCTTCGAGGGAATCTCGCACCGCGTTAGTTAGTTTCCAACCTTGAAAGCATCGGA
GACGCATTTTTGGCGATTTTGCTGGATTGAGCTGAATGGTGCCAGGTCGAGGCTGGGAGG
GAGACTAACTCGAAAGTGACGAAGACTCGAAAATTAAAAAAAAAGATACTGCAGAAGGCA
AGATTGAGAATGGAGTAAAGGCAGCGTGGGTCCCCTGTGGAAACCGCAGTTTTCCTGCGC
CAAGTGGTACCGGTGCGAGTGCAGCAATTAATCTCTCGATATTTTCTTAGTATCTCTTTT
TATATAAGAATATATTTTGGAATTGGTAATGCTTATCTTCAATAGTTTCTTAGTTGAATG
CACACTTAAGAGCAAATTGGCCAAGGAGTTCTTCGTTCGCTTTAATTTATTTCCTGGTTA
TTGTCAATTTATTCATCCCATCTCCCCAGGATAGAAGAAATTAGTGTAATTTTGCTGACA
ATACATTTTAACGACGATAACAATAATAGCAATTAAATAAAATAGCACTACCACCACTCC
ACTGCTCGTTAGCTATTTCTGTAAAATAAATAAAAAGATC
Chr coordinates Chr XIII from 662644-664284
w3c xhtml validator w3c css validator