Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SKY1
Systematic Name YMR216C
Strain S288c
Description SR protein kinase (SRPK) involved in regulating proteins involved in mRNA metabolism and cation homeostasis; similar to human SRPK1
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SKY1 YMR216C
GAACGTTCAAATCAAAGATAGCATGGTCTACGTGTGGAGCGTCTTCAGCGTATACGGAAT
ATGGACCACCAGAAAGAATGACACCCTTTGGAGTCCAGCCCAACTCAGAGATCTTCTGAG
TGCATGGCAACATCTCAGCATAGATGTTAAACTCTCTTAATCTTCTGGTAATCAAATGAG
AGTATTGAGAACCAAAGTCTAACACTAAGATAGTGTCAAACATGTTAGAAACTTGTTCAC
CGGCAGCCATTGTGAATATTGATGTCGTTAGTTTATTTTAGAATATAGATATTACCTACC
AAATGACCCAGGGAAGTTAAACTACAACGAACGCAAGCTAATTAGAGACTACCGTGACCG
AAACTATAACTCAACTAATGTTTTATAACTGTGAAATGAAAATGAAACTGAAAAAATGAT
AAAAAAAAGAAATATTTTTTCTCGATGCTCATCGCCAAAGAAAAAAAAAATTTTCATTTC
CTGCAAGCAAGAAAAAGAAATGACGGCATGAAAAGAGTCAAAATGTCGGGAACCGAAGCC
ATTGTAGGGGAGCGAGAGGATGAAAGCATATTCCTGTCACCAACGTCACGAAGAAATGAG
TCGGCTACTTGACAACCTTGTTTTTTCGCTGTTAAACATAATTAAAGGTTCTATTTGGCA
ACACCTCATAATTATATCACTATCCACGTGATATTAAATCGTTACGGACGAGCCTATATT
ATTTCCGGATTTTTTTCTAATTTCTTTTTCTATTTTTCTAAATCTTATCGTCGTTATTTA
TTTGAAAGAGAATAAACAATGAGTGTGGGCTATGAAAGAGCTATAGAGAAGTCACAGGAT
ATAGAGGGATCTATTTGTAGCTGGCAAGTTAATAGAGATTGGAAAACTGATTCAAAATTG
TTAGATCACCTGGCGCTGAGAAATAATTGTGTTTTTTGGTATAAATAGACACCCCCTTTT
GAGGTTGAAGAGATAGAGTAAAGAAGAAGTGTAGACATTA
Chr coordinates Chr XIII from 701039-698811
w3c xhtml validator w3c css validator