Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FSH2
Systematic Name YMR222C
Strain S288c
Description Putative serine hydrolase that localizes to the cytoplasm; sequence is similar to S. cerevisiae Fsh1p and Fsh3p and the human candidate tumor suppressor OVCA2
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FSH2 YMR222C
TCAGCGCTCCATAAAGTTCATGAACAATTTTATCGAGTGCACATGAAAAACATTTATCTG
GAGAACGCACTTTACAATTATTAGAATGAATTTGACTCATTGAGTGCCTAATAAAGTAAG
GGTTATGGATTAGACATTGGAGAATACTACTCATGAAACAAGTGGATCCCATGTTGATCA
GGCCAGAAAGCCCATCTCTTCTTTCCATGCTAGGAACCATGGTCTTTGTGCACACGTCGT
CCCAATACTTCGCTAGGATAGCATCGTTAATCAGATCGATATTCCCTATATAGTCCTCAC
ATTTGAAGCAAAATAAAAGGCCATTATTTGAGTTGATACCAAATATGTGACCAATCTGTT
TACTGTGAGAGAGAAAATGCGAATGGTTCCAACATCCACAAAATCCACATTGTAGACACA
TGAAAGTTGCACCAGAGTTTATTTCGTGGCATGTACCACATTTCATGGTGTTTAAGAATT
TTTCCTTGGGTACGGAATGATTTAATATATACCTGGCAGCATTGCACGTTTTTAGAACCC
CATCTTTAGACTTTTCATTCTGAAATACTTGCTGTATATGTGGACAAATGCTCATAATTA
TTAATAACAAATAAAAAAAGCAGGGTTTCAAGTAGGACGACGAGGACCGAAGCTGTAGTT
TTCCCTTTTGATCCGATCAATAAATAGTATTCAAAATTATGACAGCCAGTTGAAAGAAAT
GGACTAACTGGTCTCAAAAGAAAACCTTTATTATTATCCGTAAAATATCTTTTTAGAATT
AATCAGGTCCACTAATATAATCCCTTTGCTATTACGACAGCTTTCTAGCCCATATACAAT
ATAAATTATTGATGCTTTTTACACACTATAATCGAGGATTTTTTTTCACTTGAAAAATTC
AAAGAAAAGCAAAAAAAGGAAGAATAGAGAAGAAAAAAAAGGTATAAGTGAAGAAAGAAT
GTGCAATACTACAAGACTATAAGATTTAATAGCTGTAACC
Chr coordinates Chr XIII from 716309-715638
w3c xhtml validator w3c css validator