Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MRE11
Systematic Name YMR224C
Alias NGS1, RAD58, XRS4
Strain S288c
Description Subunit of a complex with Rad50p and Xrs2p (MRX complex) that functions in repair of DNA double-strand breaks and in telomere stability, exhibits nuclease activity that appears to be required for MRX function; widely conserved
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MRE11 YMR224C
TGCAGACACTTTAATCTTTCCAACAAACCAAGCGTCACCTCATCATATCTTCCGTGGATA
AACCTAGCTAAACTAAGTAAATCTGTATACTTTTTATACATGTAAGACTTTTTAGCTATT
TCATTCTTCCCTGAACCGTTTTGCGCGATTCTACGGAATATACCGGCGAAATAAAAGAGA
TAAACTTATGGATCCTCAAATAGAGGATGAACAGATGTGAAGAAGAAACGAGCTTAATTA
TATCTTCGCCATGATAACTAAATACTTCAGTAAGGTAATTGTCAGGTTTAATCCCTTTGG
CAAGGAAGGTATGTATTTTTTTTCGCTCTGTTATTCGTTCTCCTTACCTTTGGCCATCAT
GATTTAAAGATTTGGCTAAACTAGGCTGAGGTAGGCTCGAACCGATCTATCACAAATACT
AACAGCAAATGATATGGTCATATCATTGATTTCAGCGAAAGTTGCTAGGTTAGTACTTGC
TGCCATTCCACCAACGCAACGAAACATGGGCACGCAGATTCAATCGGAAATTATCTCAGA
TTACAATAAAGTCAAGCCTCTTGTGAAAGTAACCTACAAGGACAAAAAAGAAATGGAAGT
CGATCCATCAAACATGAACTTTCAGGAATTAGCCAATCATTTCGACCGTCACTCGAAACA
GCTGGATCTCAAACATATGTTGGAAATGCATTGAGAAAATAAAGGCATCTACAAATCTCA
TTGTAGGCATGCACGTTTCTAATATTCTAACAAAAACAAAGTCAGAGTTCACAAGCAAGC
CTGTAAATAATATATATGCAATTACACAAACGTATAGATAGATATACCCAACCAAACTGA
CTTAAGGTTTAAATAGTATGGCCAATCGAATAGAACCCAAACATTATAGCCATATTAAAT
TACTCTTTACGCTTGTAAGGAAGACAATGTGGAAACAACATTAAGAGAATGCAGACAATT
GACGCAAGTTGTACCTGCTCAGATCCGATAAAACTCGACT
Chr coordinates Chr XIII from 720653-718575
w3c xhtml validator w3c css validator