Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RNA1
Systematic Name YMR235C
Strain S288c
Description GTPase activating protein (GAP) for Gsp1p, involved in nuclear transport
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RNA1 YMR235C
AGTTTTCAGTTTATCCTTTTCACGTTCTAAAAATCAATACAGCGCGGAAAGTGCTCTCAA
GAAGATGAATTGAGATGTTTAAGGGTCCATTTGTTACTACATTATCGTGTAGATCTCATT
TCTCTAACTTTCCATGTAGGAAAGGGCAGGCAGGAAAAAGAACATTAGAGAACATGATCA
CGATACACGACTAGCGCATTATTTAGTGTATATTACTCTATTATGCATTCTACATGACGC
ATCTTCCGGAAGAACTTGATTTAGTGTACTTATGATATATAAGCGGTGCATTCACATAGA
CTTTGGGTCCTCAAGGTCCCACTCCTTCGCTGTGAGACAATATTTTTCTGGGGGAAGCCT
GACACCCCACGTACCCATCACTTGAGGTAATGCCTTCTTGTTTCTTTCCGCAGCTAACTG
TAACATGAGCTCCTTAGGTGCCGTAGGCTTAAATTGGTATTGTGTTCTCGCTGCAATGGC
AAGCCGTATGTCTTCTACTCCTAATCCACTGCCGGCAGAATTTCCACTGCCAGCGTAGTC
GTTGTAAACCAACGCGTCCTTAAGGACTCCTTGTGTGTACCTATGTGCAAAATCCATCAA
TTGTAGCGGTACTTGGTCCTCATATTGATGAATCGACTGTGATGCGAGGAGCAGATGCAA
AAGACGGACATCTCGTGGCGTTTCCTCTTGTGTTGAGTCCGGACCAACTTCTGATACTGA
GCCCACTGAGTTTTTATTCAAAACATTCTTGCCTCCGCCGTTCATAATGGTCTGTGAAGT
CCTCTAGTCTTTTCTTGTTGTCGTGTTGTTTCATAATGTCAAATTCTACTTTTGATTTAA
AGCTCTTAGTTTGGTCATGGAATGCATGTCACTATGCACGTTGTGGGACAATTAATGGAA
AAAAATTTATTAGGAAGATATTGATCAAAGGCATAATATCACGGTAAAAGGTGAATATAG
GCCATTTTAACAGGCTGTCTTTCGAAACAGATTTTTAGCT
Chr coordinates Chr XIII from 742735-741512
w3c xhtml validator w3c css validator