Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RNA1
Systematic Name YMR235C
Strain S288c
Description GTPase activating protein (GAP) for Gsp1p; involved in nuclear transport
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RNA1 YMR235C
AGTTTTCAGTTTATCCTTTTCACGTTCTAAAAATCAATACAGCGCGGAAAGTGCTCTCAA
GAAGATGAATTGAGATGTTTAAGGGTCCATTTGTTACTACATTATCGTGTAGATCTCATT
TCTCTAACTTTCCATGTAGGAAAGGGCAGGCAGGAAAAAGAACATTAGAGAACATGATCA
CGATACACGACTAGCGCATTATTTAGTGTATATTACTCTATTATGCATTCTACATGACGC
ATCTTCCGGAAGAACTTGATTTAGTGTACTTATGATATATAAGCGGTGCATTCACATAGA
CTTTGGGTCCTCAAGGTCCCACTCCTTCGCTGTGAGACAATATTTTTCTGGGGGAAGCCT
GACACCCCACGTACCCATCACTTGAGGTAATGCCTTCTTGTTTCTTTCCGCAGCTAACTG
TAACATGAGCTCCTTAGGTGCCGTAGGCTTAAATTGGTATTGTGTTCTCGCTGCAATGGC
AAGCCGTATGTCTTCTACTCCTAATCCACTGCCGGCAGAATTTCCACTGCCAGCGTAGTC
GTTGTAAACCAACGCGTCCTTAAGGACTCCTTGTGTGTACCTATGTGCAAAATCCATCAA
TTGTAGCGGTACTTGGTCCTCATATTGATGAATCGACTGTGATGCGAGGAGCAGATGCAA
AAGACGGACATCTCGTGGCGTTTCCTCTTGTGTTGAGTCCGGACCAACTTCTGATACTGA
GCCCACTGAGTTTTTATTCAAAACATTCTTGCCTCCGCCGTTCATAATGGTCTGTGAAGT
CCTCTAGTCTTTTCTTGTTGTCGTGTTGTTTCATAATGTCAAATTCTACTTTTGATTTAA
AGCTCTTAGTTTGGTCATGGAATGCATGTCACTATGCACGTTGTGGGACAATTAATGGAA
AAAAATTTATTAGGAAGATATTGATCAAAGGCATAATATCACGGTAAAAGGTGAATATAG
GCCATTTTAACAGGCTGTCTTTCGAAACAGATTTTTAGCT
Chr coordinates Chr XIII from 742735-741512
w3c xhtml validator w3c css validator