Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL20A
Systematic Name YMR242C
Alias eL20, L18A, L20A, L20e, RPL18A2
Strain S288c
Description Ribosomal 60S subunit protein L20A; homologous to mammalian ribosomal protein L18A, no bacterial homolog; RPL20A has a paralog, RPL20B, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL20A YMR242C
GCGTGATAGCGGTCCATGACTTCCACGTCTGGAACTTAACTGAATCAATATATATTGCAT
CTATCCACGTTCAAATAGACTGTGCACCTGATAAATTCATGAGCTCCGCCAAGCTGATAA
GAAAAATATTCCATCAACACGGTATTCATTCTGCAACTGTTCAACCAGAATTTGTTTCTG
GAGATGTTAATGAGGATATTCGCAGAAGATTTTCTATCATAGCAGGTGGTTCACCATCTT
CGTCTCAAGAAGCCTTTGACAGCCATGGAAACACTGAGCATGGTAGAAAAAAGCGTTCAC
CTACTGCCTATGGTGCTACTACAGCATCATCTAATTGTATTGTAGATGACGCTGTAAACT
GCAATACTTCCAATTGCCTGTAATAAAGATATAAAGGGCTGAAGCCGTCGGTGAATTTAT
CCCATGGTTCTACAGAGAACATAAACTATATACTATTTACATAATTAATTCTTAGACGTA
TAGGAAGAAGGCAGTTCTTCCTAACTCAAGAACTGCGTTATTCAATGTATGAATACGCTA
TCTTTTAGCTATAAATCTCCATTAAAAATTTGTATGCAATATGTGCCACAATCCTTCCTC
ATCTTTTTTTTGAGACTTTTAACCCAAACATAAAATACCCCCATACATCCAGAATAGCGT
TTTTATGTCTCAAATAGTTAACTTTTTTCAGCGCGCGCAGAGCAGGAAACAAATTAAGCT
CACTTCGGTGTGGTACCAGCCCAGGAATACCGCTTCTCAATAAGCGTTCCCCTCTAAACC
CTGCTGCAATTTACTAAGTGCATTGAGGCAGAATCCAGCGCACATTTGATGCTCTTAGCC
CAACTCTAAGCCGGGCGCCTGCTTGTTCCCTCCTGTACCAAAATCTGACCGTGGCAAGGT
ATCGCCAAATTTCATTTTAAACATTGAGGTTGAAGAATTTGGACAATCATAAGCATCTAT
ATAGTTCCTCAAGTCTTTTAAGGAAAAACAGTGCGGAAAA
Chr coordinates Chr XIII from 753742-753225,754220-754220
w3c xhtml validator w3c css validator