Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HOR7
Systematic Name YMR251W-A
Strain S288c
Description Protein of unknown function; overexpression suppresses Ca2+ sensitivity of mutants lacking inositol phosphorylceramide mannosyltransferases Csg1p and Csh1p; transcription is induced under hyperosmotic stress and repressed by alpha factor
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HOR7 YMR251W-A
ACCGAGGCGGACGTGAGACTCTACCCAACGATAGTAAGGTTCGACGTGGTATACCATCAA
CACTTCAAATGCAATCTGGCCACCATCAGAGATGATTATTCCCGTATACACACGTGGCTC
AAGAATATATACTGGCGCCACGAAGCCTTCCAGCGCACAACGGACTTTACCCACATAAAA
CTCGGATATACTCGCTCGCAGCCACGGGTCAACCCGATTGGGATCACCCCACTGGGGCCC
AAGCCTGATATCCGACCTCCATGAAATTTTTTTTTTTCTTTCGATTAGCACGCACACACA
TCACATAGACTGCGTCATAAAAATACACTACGGAAAAACCATAAAGAGCAAAGCGATACC
TACTTGGAAGGAAAAGGAGCACGCTTGTAAGGGGGATGGGGGCTAAGAAGTCATTCACTT
TCTTTTCCCTTCGCGGTCCGGACCCGGGACCCCTCCTCTCCCCGCACGATTTCTTCCTTT
CATATCTTCCTTTTATTCCTATCCCGTTGAAGCAACCGCACTATGACTAAATGGTGCTGG
ACATCTCCATGGCTGTGACTTGTGTGTATCTCACAGTGGTAACGGCACCGTGGCTCGGAA
ACGGTTCCTTCGTGACAATTCTAGAACAGGGGCTACAGTCTCGATAATAGAATAATAAGC
GCATTTTTGCTAGCGCCGCCGCGGCGCCCGTTTCCCAATAGGGAGGCGCAGTTTATCGGC
GGAGCTCTACTTCTTCCTATTTGGGTAAGCCCCTTTCTGTTTTCGGCCAGTGGTTGCTGC
AGGCTGCGCCGGAGAACATAGTGATAAGGGATGTAACTTTCGATGAGAGAATTAGCAAGC
GGAAAAAAACTATGGCTAGCTGGGAGTTGTTTTTCAATCATATAAAAGGGAGAAATTGTT
GCTCACTATGTGACAGTTTCTGGGACGTCTTAACTTTTATTGCAGAGGACTATCAAATCA
TACAGATATTGTCAAAAAAAAAAAAGACTAATAATAAAAA
Chr coordinates Chr XIII from 774752-774931
w3c xhtml validator w3c css validator