Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PET111
Systematic Name YMR257C
Strain S288c
Description Mitochondrial translational activator specific for the COX2 mRNA; located in the mitochondrial inner membrane
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PET111 YMR257C
CTCCAAATACTTACCATTATTTGATAAGTACATCATGAATCATCAATACTTTTCGACCCC
GGATGCAAGATACTTGGATATTATACCGATAGTGTTTGCAGCATATACTGGAAAATCTCT
AGCTAAGAGGTTTGATCCTCAGAAGAACTGGGATTTGGATTTACTACAGTATGCCCCTGA
GGATACGACGTGGAATTTCCATGGCTTTGAGAGAATTCATCACTTTGCAAGTTATGAATG
TTATTTTGACGAATCCTCATTTGAGCCCTTAGCCACTATTATATCGCATTTTTTTTATCC
TTACATGAACTACTTGATAAAGATATTGCCAAACCTTCGCCAAACTATGTTGTCAGGAAT
ATACTTTAGCGTGAGCCCAGAATTACACACTTATGAAACTATTTATGATTAAACTTGATA
GTTGTGATAAACATTTCTTATGTACATTTGTTGAAGGAGTTCGTATATATACAGCCAGTT
GAGTAATAATTATATTTTACTATTGCATTTCATAATTATTACCCGGACCTTACGAGTTCT
TCGAATAATAACCATATATTTCAGAAAGGTAGGCATACCGAAGGAAGAGACAATGAAAAA
ACTGAAATGAACAAGCTTCTGTATACGATCCAAGGATCAGAAACGGTTGTTATTTATTGT
TTGGACTTCTTGTTGTTAGGCTTTATTTACCGTGCATAATACTATCTGATACTTTGAGAA
ACCCCTCCCCCCACAGAAAGGTTCAAAATTTACAATTGCTGCACTAGGTCTACACTTTCC
TCTAGATTTGTAACTTGAAGACCCCATTCCAATCGTTTAACCTGTCTTTCCTTTTATTAT
CGTTTTATTCTCTTCCTTTTTTATAAAATTCTATCTGGTATAGAGCATTTTTATGTTGAT
CATAACTTTTCATGTATTCTATTAATTACACCACAACTTTGATATCGTCAAATTTTTTAT
CACTACCTATTAAATTTAAACAATTGCTTACGAGAACTTA
Chr coordinates Chr XIII from 782031-779629
w3c xhtml validator w3c css validator