Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RCE1
Systematic Name YMR274C
Strain S288c
Description Type II CAAX prenyl protease involved in the proteolysis and maturation of Ras and the a-factor mating pheromone
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RCE1 YMR274C
TGAACTGTTGATGAACAAAGAGAAGCTGACAAGCATCAAAGCTTTGTACGATGATTTCCA
TTCAAAAATTTGTGAATATGAAACCAAGTTCAACAAGAATTTTCTTGAATTAAATGAGTT
ATATAATATGAATAGGGGAGACCGTAGGCCAAAGGAACTGAAATTTACAGATTTTATTAC
TTCACAGCTGTTTAACGATATCGAAAGCATTTGCAACTTGAAAGTTAGTGTTCACAACTT
ATCCAACATTTTTAAAAAACAGGTCAGTACCCTAAAACAACACTCAAAGCACGCATTATC
TGAGGATTCAATATCGCACACAGGTAACGGTAGTTCATCGTCGCCCAGTTCAGCGTCATT
AACGCCAGTAACTTCTTCATCCAAGAGTAGTTTATTTTTACCTAGCGGTAGCTCGTCTAC
TTCCCTGAAATTTACAGACCAGATTGTTCATAAATGGGTTAGGATTGCTCCTTTACAGTA
CAAACGAGACATTAATGTGAACTTGGAATTTAATAAGGACATTAAGGAAACTTTAATTCC
AAGTTTTGAAAGCTGCCTATGTTGTAGGTTTTATTGCGTTCGAGTAATGATTAAATTTGA
AAACCATCTTGGCGTAGCGAAGATTGATATCCCTATTTCTGTTAGGCAAGTGACAAAATA
AAAAAACATTAGAAAAAATTCTCGTTACTTTTCTTATAGATATAGATATATGTATGGTTT
GCTTATAGATGAAGGTATTTATCGCGTCCTTTGTATTCCCTATTATTAATAAAATTCTTT
TAAAATGCATTTTCTGGTGCTCTTTTGTTGCTTCTGTATTTTTTTTTTTTTGGACCACTG
GATGGAAAACCTTTGATGATTTTATTACCTTTATTTTAAGTTACTAAAATATCGAGATTT
CAGGAACAAAACATAGAATTTTCTTTGTCAAGAAAAATAAAACGAAATAAATTGATGCTT
TGACTACTGACTGTCTGTCATAGAGAGAACCAGAACAGCA
Chr coordinates Chr XIII from 815311-814364
w3c xhtml validator w3c css validator