Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DSK2
Systematic Name YMR276W
Strain S288c
Description Nuclear-enriched ubiquitin-like polyubiquitin-binding protein, required for spindle pole body (SPB) duplication and for transit through the G2/M phase of the cell cycle, involved in proteolysis, interacts with the proteasome
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DSK2 YMR276W
GACATTTTTGGTAAAGTGTACAATTTGTCGATGAAAATGTTGTCTGTATCGTTCAAGTCA
TCAAGTATGGGAGGTATATCCAGTGAATCTTCATCGACAGCGGTTGATTGATGTGCTGCA
ATACTGTGATGTTCGGTTCGAAGGGGAATTAAGTTTTCTAAATTTGATGTTGACGAAGAA
CGTGTGGCACCCAATGCGTCAGTGGACAATGATTGATGTGAGAGATCAGCGCTCGAGCCC
GCAGCACCTGTTGCAGTAGAATTATTGGCCTCTTGGTATGAAGGTGGGAAATCATGCCTA
TCTGGATCGACGTTGCCCTGCGGAATGTGCCTATGCAGGGTATTGTACATCTCAAATGAG
GGCAGTACATCAACAACATTGTTGATATCTCCGTCGGTCAAGGACCTTCCGGTCTCGACG
GGGGTCGCATTTGCAGTTGATCTTCTCAAAGGAGAACGATTACCTCCAGCAGGCGTTCCG
GTGGAAGGAGCATGCGAATGAGAATGTGCTAGTTCGGGACGTCTTAGTCCAAGGATCCCC
GTAGCAGACGCGCTTCTTATCCATGATTTTGGAGAGTGTAACGACGGTGACCTCGAACTG
CCTTTACCACCCTCTTGTTTCTGCCTACCACGCCCCCTTGTGTTTGCATTAACGTTCATA
GTTGTCGAACTATTTGCGGTAAAATCAGATCGTTGAGGACGCAGCAAAGGCTTCCTCTTC
GGTGGAAACCCCGAATCGTTCAAATCTTTGGCCATTTAGCGTACGATATACCTGTTGACA
CACACGAACAGTCTCTTTTCGCCCTTGCTAAGAGCTTCTTTCCATAATCACTATGCGGCT
CTTCATTGCAATACTTTTATCATTATTAAAATAGCCTCTGAGAGCGGGTCACGGCCCGCT
GAAGGGAAAGAACAATTTAAAGCCAGTTTTAAGTTCAATCCACCGATGGACGAGAGGCAA
ATAAGACGGATCAAAGACACCGAATCATTCTAGCACGATA
Chr coordinates Chr XIII from 818827-819948
w3c xhtml validator w3c css validator