Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DSK2
Systematic Name YMR276W
Strain S288c
Description Nuclear-enriched ubiquitin-like polyubiquitin-binding protein, required for spindle pole body (SPB) duplication and for transit through the G2/M phase of the cell cycle, involved in proteolysis, interacts with the proteasome
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>DSK2 YMR276W
ATGTCGTTGAATATACATATCAAGTCAGGACAAGACAAGTGGGAAGTAAATGTGGCACCT
GAAAGCACAGTGTTGCAATTCAAGGAGGCGATAAACAAAGCGAACGGTATCCCGGTGGCA
AATCAGAGATTGATCTACTCGGGTAAGATTTTAAAGGACGACCAAACCGTGGAGTCATAC
CACATTCAAGACGGTCACAGCGTCCATCTGGTCAAGTCACAACCCAAACCACAAACCGCC
AGTGCCGCTGGCGCAAATAACGCCACCGCCACCGGTGCAGCAGCTGGCACTGGCGCCACC
CCGAACATGTCGTCAGGTCAAAGTGCAGGCTTCAATCCGCTGGCCGACTTGACCAGTGCC
AGATACGCTGGATATTTGAATATGCCATCTGCAGACATGTTTGGCCCGGACGGTGGTGCA
TTAAACAACGACTCGAATAACCAAGACGAGCTGTTGAGGATGATGGAAAACCCCATCTTC
CAATCGCAAATGAACGAGATGTTGAGTAACCCTCAGATGTTGGACTTTATGATCCAGTCC
AACCCGCAATTGCAGGCCATGGGTCCACAAGCCAGGCAAATGCTACAAAGTCCCATGTTT
AGACAGATGCTCACCAATCCTGATATGATTAGACAGAGCATGCAATTCGCAAGAATGATG
GACCCTAATGCCGGTATGGGCTCTGCAGGTGGGGCTGCCTCTGCCTTCCCCGCTCCTGGT
GGCGATGCTCCAGAGGAAGGCTCCAACACGAACACTACTTCCTCATCCAACACAGGGAAC
AACGCAGGGACTAATGCAGGTACCAACGCAGGCGCTAACACAGCTGCAAACCCATTTGCG
TCTCTTCTGAACCCTGCATTAAACCCCTTTGCTAACGCGGGAAACGCTGCATCCACCGGG
ATGCCCGCCTTCGATCCTGCATTGCTAGCGTCTATGTTCCAACCCCCTGTACAAGCATCT
CAAGCAGAAGACACCAGACCACCGGAAGAACGCTATGAACATCAATTAAGACAACTAAAC
GACATGGGCTTCTTCGATTTCGATAGAAACGTCGCAGCCCTCAGGAGAAGCGGTGGCTCC
GTCCAAGGCGCTCTTGATTCACTACTGAACGGCGATGTTTAA
Promoter Sequence
Download FASTA
>DSK2 YMR276W
GACATTTTTGGTAAAGTGTACAATTTGTCGATGAAAATGTTGTCTGTATCGTTCAAGTCA
TCAAGTATGGGAGGTATATCCAGTGAATCTTCATCGACAGCGGTTGATTGATGTGCTGCA
ATACTGTGATGTTCGGTTCGAAGGGGAATTAAGTTTTCTAAATTTGATGTTGACGAAGAA
CGTGTGGCACCCAATGCGTCAGTGGACAATGATTGATGTGAGAGATCAGCGCTCGAGCCC
GCAGCACCTGTTGCAGTAGAATTATTGGCCTCTTGGTATGAAGGTGGGAAATCATGCCTA
TCTGGATCGACGTTGCCCTGCGGAATGTGCCTATGCAGGGTATTGTACATCTCAAATGAG
GGCAGTACATCAACAACATTGTTGATATCTCCGTCGGTCAAGGACCTTCCGGTCTCGACG
GGGGTCGCATTTGCAGTTGATCTTCTCAAAGGAGAACGATTACCTCCAGCAGGCGTTCCG
GTGGAAGGAGCATGCGAATGAGAATGTGCTAGTTCGGGACGTCTTAGTCCAAGGATCCCC
GTAGCAGACGCGCTTCTTATCCATGATTTTGGAGAGTGTAACGACGGTGACCTCGAACTG
CCTTTACCACCCTCTTGTTTCTGCCTACCACGCCCCCTTGTGTTTGCATTAACGTTCATA
GTTGTCGAACTATTTGCGGTAAAATCAGATCGTTGAGGACGCAGCAAAGGCTTCCTCTTC
GGTGGAAACCCCGAATCGTTCAAATCTTTGGCCATTTAGCGTACGATATACCTGTTGACA
CACACGAACAGTCTCTTTTCGCCCTTGCTAAGAGCTTCTTTCCATAATCACTATGCGGCT
CTTCATTGCAATACTTTTATCATTATTAAAATAGCCTCTGAGAGCGGGTCACGGCCCGCT
GAAGGGAAAGAACAATTTAAAGCCAGTTTTAAGTTCAATCCACCGATGGACGAGAGGCAA
ATAAGACGGATCAAAGACACCGAATCATTCTAGCACGATA
Chr coordinates Chr XIII from 818827-819948
w3c xhtml validator w3c css validator