Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YMR279C
Systematic Name YMR279C
Strain S288c
Description Putative boron transporter involved in boron efflux and resistance; overexpression mutant but not null mutant displays boron tolerance phenotype; identified as a heat-induced gene in a high-throughout screen; YMR279C is not an essential gene; paralog of the efflux pump ATR1
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YMR279C YMR279C
ACCGACTCAATTTTAAGTCAAGGGATGGTATCCTCCGTAAGTACGAGAAATACCAGCAAT
CAAAGATCTCTTTCATCGGGCAATGATTCAAAAGGTGACAGTAGTTCTCAAGAGAACTCA
AAGAGTGCAACTGGCAACCAGTTGGATACACCTTCTACACTGTTTCAAATGAGAAGGACC
TCTTCAGGGCCCTCGGCGTCCCACCGTGGTCCAAGACGGCCTCAGAAAAATCGTTACAAT
ACAGATCGATCAAAAAGTTCTGGTGGCGGAAGTTCCAACACAGATAATGTATCTGATTTA
TTCCAATGGCAAAACGCCAAATAATTCTTTATTTCATAGTGTAATATATTCAAAACGGAA
TCCTCTAAATATTCATGAAACAAATAACATTCTTACGTATAATTTCTTAATAGGGCAATT
GCCGTAGCTTTCGTTCACCTTATGAACAGCCAAATTTATTGTTGGAAAAAAGAAAAGATA
ACAAAGACGACGCCAAAACACATCTTGATGCAGCGCCCATGTTCCTCAGATTTATTAATG
GAACTACATTTCAGATTAGGAAATTTTTTTGCTAGTTCCCATGGTTACGTTACCGGAGGA
CCATCTGACAGCGCGGAGGCTGCACGGAAGGGAAGAGAAGGCAACAGGGGTGCGCATAAA
TAGCGCCGACAATGCGACGCCAAAAACGTGGCTCGTATATTGATTAAGTAAAATCTTTAT
TTTTCCTACACAAATGTCCGTAGAACGCGTAAACTTTTTTTGCTTTGTTATAGGAGTTTT
ATTTATGAGATAACAATGGCATGACGAAGATTATGCTATAGTATTGCCATGGTTACGAAC
TAAATTTTCTTTCATATCAGTTTTTCGAGGAAATACTCAGAGACATTTGGCTTGGACAAA
AATAGGTATATAAGGCAATGGAAATAGATCTTTTAACCATGGCTAGTTCTGGAAACCAAT
CTAAGCACACCAAACATACAACTCAAAGATCTGATTGGAA
Chr coordinates Chr XIII from 826351-824729
w3c xhtml validator w3c css validator