Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GPI12
Systematic Name YMR281W
Strain S288c
Description ER membrane protein involved in the second step of glycosylphosphatidylinositol (GPI) anchor assembly, the de-N-acetylation of the N-acetylglucosaminylphosphatidylinositol intermediate; functional homolog of human PIG-Lp
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GPI12 YMR281W
TCTTGTCTTTTACTCAACTTGTAAATTCTCTTTAGGGTGTTGTAACTGTTTATGAAGAAA
TAAATACCGTAATGAATTATTAAATTATTAAATTCTTCGTCTTTTTACAATATCACAGGT
TTAAAGGGGAGTTTAACAAAATCTACTATTTTACGGCTGTTTTCTTTTTTTGAGTGTCAC
TGACCAATCATGCTTTCGTACCCCACAAAATATCAGCCCCGCCGCTCCATGCATGTCTCG
GTTATCGCTTAATACGAATATAATCACTGAGAACCTCGGCGGCAAAAATATTTACCAATA
GGCAAATTAAACACCGAAAAAAAGAAGTTTCAAGTAGAAGATTATCCCGAATACCAAAAA
ATTGCACGAGAAAGAATGTCTTTTTATGATTTATTGCTTATAATACTCAATTACTCTGGT
TTTCTCCGTTCCTGTTACGCACATAAACTCTCTCTGTCTCTGATATCACAACTCATATCG
CGAATAAACACCGGATAGAAAGAAGTGAGAGGAGCTACGATAACTGAATATACTCTTTCA
TCAAAAGTAATGTGCTAATAAAAAGAAATGTTGCACCATCTTAACAGATGTAAAAATGTT
CTGCAGAAGGAAAGTTGTGTAATCATACACATTCAATAGTATAAGTCGTATCACAATCTG
ATGATAAAAGTTGTTACCTCTTTTAACTGCCTCTGATCCTTTTCACATTCAGTAATTTCT
CGTAGATGTATATGTGCGAATGTGTCAATGTGTTTGTATGAAATAAACTAGTAGCCGGGT
AACAAGTACTCCTAAATTCCCGCTTCGCCGTTTCTATCTCATTGGAGTCGTCCCTTCTAG
AAGGTTTACTAGTTACGTTAACGTCATAGAAAAAGGAAAATCGACGCTGCGCTTTTATTT
ATAATCTTGCATTGCCCTCCTTATTTATCGAATTGTTAAGTGTAGATAGGTGACGCTAGA
GCCGTATATTAGATTCTTTCAAACCCTGAAGAAAAGTTAA
Chr coordinates Chr XIII from 832339-833253
w3c xhtml validator w3c css validator