Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ABZ2
Systematic Name YMR289W
Strain S288c
Description Aminodeoxychorismate lyase (4-amino-4-deoxychorismate lyase); catalyzes the third step in para-aminobenzoic acid biosynthesis; involved in folic acid biosynthesis
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ABZ2 YMR289W
CAAATTTGTTGGACTTATTGGTAAATTAGCACCTACCTATGCACCTCCTAAAGAATGGAT
GAGAATATGTTTTGAACTATTAGAACTTTTGAAAAGTACAAATAAAGAAATAAGAAGATC
AGCAAATGCCACGTTTGGATTCATTGCTGAAGCAATTGGACCTCACGATGTTCTTGTTGC
GTTATTGAACAATTTAAAGGTTCAAGAACGTCAGTTACGTGTATGCACGGCTGTTGCTAT
CGGTATCGTTGCTAAAGTGTGTGGTCCTTACAACGTGCTGCCAGTAATCATGAATGAATA
CACAACACCAGAGACTAATGTTCAAAACGGTGTTCTCAAGGCCATGTCATTCATGTTTGA
GTACATTGGTAACATGTCTAAGGATTACATATACTTCATAACACCATTATTAGAAGATGC
ACTCACCGATAGGGATTTAGTTCATCGTCAGACAGCGTCGAACGTAATAACCCACTTAGC
TTTAAACTGTTCAGGTACAGGTCACGAAGATGCCTTCATTCATTTAATGAATCTTCTAAT
ACCCAATATTTTTGAAACTTCACCACATGCTATTATGCGTATTTTAGAAGGTTTGGAGGC
ACTGAGTCAAGCTCTTGGCCCTGGACTATTCATGAACTACATATGGGCAGGATTGTTCCA
TCCAGCGAAGAATGTAAGGAAAGCATTTTGGAGGGTGTATAATAACATGTACGTAATGTA
CCAGGACGCCATGGTACCTTTTTACCCCGTTACACCAGACAACAATGAAGAATATATAGA
AGAACTGGATTTAGTTCTGTGAATATATATAGAGCATATAAATAACCACAACTTGTAAGA
ATATTTTACTTGACACACCTATATCATCACGTCACGATGCCTTCATAGATTATGATGAAA
TATAAACAGAACCTGCTATTGGAAAAAAAAGGGCAGGAAAAAATTTTGTGAAAGTGAGTA
AAAGAAAGATGAAGAGCGAGACATGGATAATAAGAAATAG
Chr coordinates Chr XIII from 848685-849809
w3c xhtml validator w3c css validator