Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LIP1
Systematic Name YMR298W
Strain S288c
Description Ceramide synthase subunit; single-span ER membrane protein associated with Lag1p and Lac1p and required for ceramide synthase activity, null mutant grows extremely slowly and is defective in ceramide synthesis
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>LIP1 YMR298W
ATGTCTCAACCCACTCCCATCATAACTACAAAATCAGCTGCTAAGCCAAAACCAAAAATT
TTTAATTTATTCCGCGTTTGCTTCATTTCATTATTGCTGATCGCTGCGGTTGAATACTTC
AAGTATGGTACAAGAATTAACTATGAATGGTTCCATTGTACCCCAATCAAAGAACCCCAG
TCTGGCTCAGTAATCAAGCTTTGGGCACGTGGTGGGCCAAGTTGTGACAAAAGAGGCGAA
TATAAAACTATAGTAAAGAGAATCACTAGAGATTATGAACCAAATGATGAACATCTCTCG
TTCTGTATCATCGAGAATGATAATGTTCCACCCGTCCACTACCCAATTCACGAAGATAAA
GGTGAACCTGGCTACGTAGCTTATGTCGGGTACGACACAGACTCTGAGCTGGTTCAAGAA
CTATGTGCTGATTCCACAATTTATCACATGTGA
Promoter Sequence
Download FASTA
>LIP1 YMR298W
GAACCAATGGCCTGTGGTGAAGGTGGCGAACCATCTGTTTTGCCCTCGGAGGAATGCTCT
GCTATGGAAGACTCTTTGGAACGTTGTTTGGGCTTGATCGAGTCGTGCTATGACTCGCAA
TCCGTCTGGTCCTGTGTTCCAGCTACCATTTATTGTAATAACGCCCAATTGGCTCCTTAC
CAACGTACCGGCAGAAACGTTTACGATATCAGGAAGGATTGTGAAGGTGGCAATTTGTGC
TACCCAACGTTACAAGATATCGACGACTACTTAAACCAGGACTACGTCAAAGAAGCTGTC
GGTGCGGAGGTTGACCACTACGAATCCTGTAACTTCGATATCAACAGAAATTTCCTGTTT
GCGGGTGATTGGATGAAGCCTTACCACACCGCCGTAACAGATCTTTTGAATCAAGACCTA
CCCATTCTGGTATATGCAGGCGATAAAGATTTCATCTGTAACTGGTTGGGTAATAAGGCG
TGGACGGATGTCTTGCCATGGAAGTACGACGAAGAATTTGCAAGCCAAAAAGTACGTAAC
TGGACTGCTTCTATCACCGACGAGGTCGCTGGTGAAGTCAAATCCTACAAGCACTTCACC
TATTTGAGAGTCTTCAATGGTGGCCACATGGTTCCATTTGACGTCCCTGAAAACGCCTTA
AGTATGGTTAACGAATGGATCCACGGTGGTTTCTCCTTATAAAGCGTGTATGTGTAGGCA
TACCGTTTTTATTATCAGCTACGATCGAAATATATACGTTTTTATCTATGTTACGTTATA
TATTGTAGTCTTAACCATTTGTAAGTTTTGCTTCTTTTCTTTTATTCATTTCATAACATC
ATACTGTTTTACGTAATACCATCCTTAACTTTTTCCACCGAAGGGGAGGAAGAACTAAAT
TCTAGAAAAATGAAACCATTAAAAAAAAAGAAAACAATAGAGCTGCTTCTACAATTTTGC
ACATCAAAAAAGACCTCCAACTACCGAGTTTGTAAGTACA
Chr coordinates Chr XIII from 863819-864271
w3c xhtml validator w3c css validator