Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ADE4
Systematic Name YMR300C
Alias amidophosphoribosyltransferase
Strain S288c
Description Phosphoribosylpyrophosphate amidotransferase (PRPPAT; amidophosphoribosyltransferase), catalyzes first step of the 'de novo' purine nucleotide biosynthetic pathway
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ADE4 YMR300C
GGTGTGGTACCACAGGACACACCACTTTTCAATGACACTATCTGGGAAAATGTAAAGTTC
GGTCGTATTGACGCAACCGACGAGGAAGTGATAACTGTAGTTGAAAAAGCCCAGCTAGCA
CCCTTAATCAAGAAATTACCACAAGGTTTTGACACCATCGTCGGGGAGCGAGGGTTGATG
ATCAGCGGTGGTGAAAAGCAAAGGCTGGCAATTGCAAGGGTACTATTGAAGAATGCAAGG
ATCATGTTTTTTGACGAGGCCACAAGCGCCTTGGACACACACACAGAACAAGCTCTCTTA
CGAACCATTAGAGATAACTTTACTTCGGGTTCGAGAACGAGTGTATACATCGCACATAGA
CTGAGGACAATTGCAGATGCAGACAAGATCATAGTCCTTGACAACGGAAGAGTAAGAGAG
GAAGGTAAGCATCTTGAACTGTTGGCTATGCCAGGGTCATTGTACCGCGAACTTTGGACC
ATACAAGAAGATCTGGATCATTTAGAGAATGAACTAAAAGACCAGCAAGAACTATGAACG
CTCGTAAGTAAATATTGATTTATACATGTATAAGTTTTTCAAGATTTAAGGAAAAAAGAA
AAGTTATTATCTTTCTCCGCGGTTTTTCAATGACCCGATGTATTGACTCTTCCTGACCGA
AAATAACAGGACAGAGTTAGAACGAACATGAATAATAAAATATAATCTGGGATCATGAAT
CCGAATGACTGCTCATGCGGCAAATGTCAGAGCTTCGGTGTATTTAAAGTTTGCTTACTT
ACAATTTCAATAATAGGTTTGTACTTTTCAGATTCTTATTATTAAGTCAAGGTAAAGTCC
TTCGTTTTTTTTTTTTTCATTTTAGAAAAATTTCAACAGCCACCGTACAATTTTATTCAC
TTTTAAGTCATAGTTGCGAAGACATCGTCTTGAAAGTAGTAGATTTCGTTCTAATAAGTT
TAGCAAAGAAAGAGGTACAGCAAACAGCAGAATAGAAAAA
Chr coordinates Chr XIII from 867091-865559
w3c xhtml validator w3c css validator