Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SCW10
Systematic Name YMR305C
Strain S288c
Description Cell wall protein with similarity to glucanases; may play a role in conjugation during mating based on mutant phenotype and its regulation by Ste12p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SCW10 YMR305C
GGGACTTCATCGTCTTGGCACCAAGCAGGATACTCAACGTCAGTTAGCGAAAACTTGGGA
CTCATAAAATCCATATTCAACTCCTTAACTTTCCTTCTCAGTATGTTTTTCTTTTCCCAA
TATGCAGTTCCACAGCCCTTAATGATTAAGTTGTATAGTGGCAAATCCTAGAAGGCATAA
TTACTTTTGAAGGTTCTCGCCAAATAGCCGCTGACCATGTAAAACTCTTACCCGCATAAT
TTAACCATCATTGCCGCACTAGGCAAGATGGTCCGATCTTGATGGGCGAGAATGATTAGT
TCAGAGACGTGCAACAGCCATATACGAAAGCTGTCTCGGCCTTCACTTATGCTGATACCA
GGCACGGTAATAATTAAGAAAGAATGCCTCCCTCTTTCTTTTTCTCAGGCAAGACATCTA
GATTTTCTTTTTATCTAAGCCCTCAATGACAAAAATATTTGTTCCTTACATATCCCCAGA
GATCTTCGGTCTAGATTTCGCGAAAGACCGTTTGCAGTAATTTACCTTTTTCGGAAAAGT
CCTCGAAGATTTCGGACGAAGTAAAACCTGAAGAGAAAAATGCCAAGACTTTTAATTGCG
CGAAACAGCGGACAAAAAATTCGCGTTGAAACGTTTGAATATGGTAACAAACGTCGCACG
CGTTTGAAAGTTATTCGTGTTTTCATGTGTACAGTAACTTCTCCATCGAGAGCCGTATCC
ATAAGCCTTCTTTTCCACGTTTGTTTCAAAACTGTAGTATTTATAATGGAGGGAAAGATG
TCTGCGTGAAGTTTGTCTTACAGTGTATCTTTGAAGCGTGCATCATATTTTTCCCATTTT
AAATTCATCTATTATATAGGCCCAAATAAAAGAGTTAAATACTATACTTTTGCAATATTG
AGCTGAACATCCAACTGTCACGTCTCTCCTTTACTATTACTGTTCTTTTTTTCAAATTGT
CAAAAGATAGTATTAACGCAAAAAAAGTCTTCATTCCATT
Chr coordinates Chr XIII from 880232-879063
w3c xhtml validator w3c css validator