Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PRE5
Systematic Name YMR314W
Strain S288c
Description Alpha 6 subunit of the 20S proteasome
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PRE5 YMR314W
CCCAGTGACAACTTACATCTTTGGAAAAAGGATGTTGGAGTTAAAGTTTGATTATTTAAT
ATATCCAAGCCTTCTAGAATTCGGGTCAAATATTGTTCAATAAGTAGCTTTGTACCCATC
AAAGATTTTGTGAACAACTTTTTATCTCCAATACCCGCAAAGTTCCTCAACATACAAGGG
CCTGTAGTCGAAAACTTCTCCTTAACTACATCATACTTCTCCTCCCTTAACATATTTTCC
AATATGCTATATTGTTCAATGACAGAATTGAAGTCGTACCTCCTCGAAAAGAAATTCCGC
CGCCATAAATTTGCGCCTGTTATTTCATCCACTACGGACGCTTGCTGACACCACATTTGA
TACGTATCACACTCATCTAACTTCTTAATAGCGTTATAATAAATGACTCTTGAGTGTGGC
CGCACATAGTTAATCAGCTTTTGAACCCAGAAGAAATAAATATCGGTGATGACATGTAGA
ATTTCCCACACAAAAGGAGGTATATGGTCCAATGTGGCATACACTACACGCAGTATCCAG
TTTTTCAAAAGGGTCGGTATTACAGCAGACACCTTGTATTCCTGCGCCGTTTCCTTCATG
CTTAACGGCAACTCAAAGATGTGATATATGAATAGATGATTCCCTTACTATTGTGTCATA
GTACTTCTCTATGTAATCAGTACTAATTTCTATTAGCTGCTACCCAGAAAAAAAAAAACA
TAAGAAAAAAAGGGTTAGGGTTGAATTTTCAGACCTAGGATAAGTATCTCCGAAATTACT
AAAAACCTAGTATTTATTAAAATGCCCTACTAAAAAAGTAAAAATGACCTATAAAGAACA
TACCCTATTATAGAGTGGCAAAATTAAAAATTCAAAAGTATCGTCAAAGTATGGAAAAGA
ACCAAGACGCCACTACATTTAGGTAGACGTGGTGATCAATTGAAGTTCAAGAGAAGTGGG
TAAGAATACATTGAACTAAGCCTTCATATATTTACAAAAC
Chr coordinates Chr XIII from 901709-902413
w3c xhtml validator w3c css validator