Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DIA1
Systematic Name YMR316W
Strain S288c
Description Protein of unknown function, involved in invasive and pseudohyphal growth; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm in a punctate pattern
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>DIA1 YMR316W
ATGGGTTCAATAAGTAGATACCTTCTTAAGAAAGCAGCAGATGGGCTTAAAGATGAGCAG
AGATTGAAGATTGAAATGTCCGATAGCAAAAGTGTCCCAGAGTGCTTTCATTTTAATAGG
GAAAGAAGAATGCCCATAGCCGAGATAAACGGCGAGGATGGGTTTTTCATGTTTCCGTCT
CAGCAATCGCTTGAAAATTTTGAAAACACTAAAAAGTATTCGAATGAGCTGAGTCCAGAT
GCAATTGGTATTCCATTATTCCAAATTATCAATTGCACTCTACCGTTTGGTAAAAGAGGT
CATAGCAATACTGTGGTCGGCAATGTCCCATATTATAAAATTTTCAAATTTATTTTAAGA
ACGGCAGACGAACCTCCGCCTTATACTGTGGCAAAAATCGTTTGCTCAAACAACGGATTA
ATATTGTATAAAGTGCCTCTTTACGACATATATAAAAATGTCAGCCAAGCAAACGTAACT
TACAGCTTCGTAGGGACTACGTCTACGGAGCCCAACTTACTAGCAATGGCTCACCGAGAA
GGACACAGGGATTTGGACACTAAAGTGAATAATTTAAATCTCAGGTGGCATGTCACTTAT
TCGCCCGTAGTTACCAACGATCATTATAAATTAATTCTGTTAGCAGATTATGAAGTGAAT
CGTTTGGATGAAGATGTCATTAGAGCCGCTAAAAATAAGATGTCCATCGACCAAAAGGAT
CAAAAAGTTCAGAGGTTCGTGGCAGCTCATTATACTAGAGAATTTGAAACATCTCTTTTT
AGGTGGGTCGCTCAAGAGGGCCACTTAATTCTTGGCGAGTATTCCACAGATCAAGGATCA
TTTGGATTGAATAATATCCCACCATTGACGGAAGAACTCGGGTGTCAGAGCCTGCTCATA
CATTACATAGAGTACATGAAGAGACAACGTAAAAAAATTGCGAAAGAGGCAAGGAGACAA
AATAAAAGAAACGTTGCAAACACGACTAACATGAACATGAACCTCATGTAA
Promoter Sequence
Download FASTA
>DIA1 YMR316W
CTACGTTAAAATTGAGCAGCCATGATTACCGTTTTACGATGTAACGCTTTTTTAACCTTA
ATAGATAGATTCCCTCATATATTTATAACTATGTACCCACATAAGTATACTTTTGGAATG
ATAATACTAACGAGATAAAAAACCGTTGAAAAATTTCTAAGTTTTCTTGAACTAAAAATA
GCCAAAATTCTCCATCCACTTGTTGTTGCAAAATGTTACGAAGGCGAGGTTCTTGGAAAT
CTGGATGATTATGGGAAAATTCGTTCAACAAGAACGCCGAGCCTGGACGAAATACTTAGT
CGGCATGGAACTAGTTATGAATGACTTTTCCTATATAAGATCTACAACCGTTTCCAATTC
ACCATGAGATATATATATGTTTAACGAATCAGGTACTCGTCCGAAGCATTTCGAGTAATG
CAACCCCACAAGTGTCCCCCAAGAATTCACTGGGATTTTTGATGACCGAAAGAAAGCTAT
TGCAGCTGCTACGGCGTCCTTTCATCTCCCTTTCTTTATTCACGGCCTTAAGAGCTTGTC
CGCTTCGCCCCAAAAGCCTAATTGCTTAGAGCATGAGAGTTGAAAACGACCAGAAGTGTC
GTTTTAGGTAAGCATTCGGCCATAATGAACAGTAAGTTTGTCCGAAAAATACACCGCTAG
GGTTCGATAACGAAGAGCGCATATCAATTGCGTTGTCGACTTAATTGCTCTCTTAGTACA
ACGGTATGTGTCAGTGATAAAATCCTACCGGTTCCACTTTTTGTGAGCGATAGATGACGG
AACGTATGCGCCTATTTCTTTTTTTTGGCGCAGCAAGGGACAATGGTCCCTTTTTGAGAA
AATGTTGTAGGCTTGGCCATCGGCGTGAACGCATATAAAAAGAAGACTGCCAACATGACA
GTATTTGAAACAACTACAGATTTGGCAAAGTTCGCCAAGATAAAGAAGACCGAAGCAGGT
GCTAAGCTTCCATTAAAAGTTTTTCAAGAAAAATCTGATT
Chr coordinates Chr XIII from 904825-905835
w3c xhtml validator w3c css validator