Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YMR321C
Systematic Name YMR321C
Strain S288c
Description Putative protein of unknown function; proposed to be a palmitoylated membrane protein; YMR321C has a paralog, SAM4, that arose from a single-locus duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YMR321C YMR321C
CCAAAGAGCTTTATTGGTGGCGAAGATAAGATGAACTTTGAAACGAAAAATTCCGCCTTC
AATAAGGCGTTAGCGAGGATCAAGACCGCAAATGAAGTCAACGCCAGCGACTATAAAATA
TTCTTTGCATCTGCTGGACATGGTGCTCTATTTGACTATCCCAAAGCTAAAAATCTGCAA
GATATTGCATCCAAGATATATGCCAATGGGGGTGTGATCGCCGCCATCTGTCATGGACCG
CTCCTTTTCGATGGATTAATAGATATCAAAACAACAAGACCATTAATCGAAGGCAAAGCT
ATAACAGGTTTCCCACTCGAGGGTGAAATCGCCCTGGGAGTTGACGACATCTTGAGGAGC
AGAAAATTGACAACGGTTGAACGCGTTGCAAACAAGAATAGAGCCAAGTACTTGGCGCCA
ATTCATCCCTGGGATGACTACTCTATTACCGATGGAAAGCTAGTTACGGGTGTTAACGCA
AATTCTTCCTATTCGACCACAATTAGAGCTATAAACGCATTATATAGCTGAAACAAAAGA
CAAGGGAATTGTTGAAGGGGAGGCTTCTAATGGCCTTCAGTTTCTGTGAAGAGAAGGCTA
ACAGCTCAATGGTTCGAAAGGTAAAGAAAACGGCAGATCGGTAGCACTCGATTTTGCTAG
AATGGAAATCATATAGAGAACAATTGAATAGTAGGCCTTGGTTTTTAGTGTTGTACTCAT
CATGGTCATATGTGACATAGGTAATGTACATATATATAAAAAAAAAAAAAAAAAAAGCAA
TGCTGTGAGATCATTCGTTACTTACGAAATACGCAGATTGCAATTTGAAATAAGCTGTGT
TTCCTTTTTTCTTTTTTTTTTTTGGCTTGTTATATACAACTTTTTTCTATTTCTGTTCTT
TTAGGAGTAATTAATTGGTACATGGGAAATAAATATGAATTATATTAAATGAAGTAAAAG
TAAAAGAAAACGGGGAAATTTATCGTTTCGTAGTAAATAG
Chr coordinates Chr XIII from 917896-917579
w3c xhtml validator w3c css validator