Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LST8
Systematic Name YNL006W
Strain S288c
Description Protein required for the transport of amino acid permease Gap1p from the Golgi to the cell surface; component of the TOR signaling pathway; associates with both Tor1p and Tor2p; contains a WD-repeat
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LST8 YNL006W
AGCCGCCAGGCATACCTCCCATGCCGCCATGCATTCCTCCCATTCCTCCAGGCATACCTC
CCATACCAGCACCGCCGCCAGATGGATAACTAGAGAAACTGAAGCCACTGTCATCAGCAC
CACCGAATGGGGAACTGCCGCCAAAGAATTGTGAAAAAATATTGAAAGCATCCTCATTAC
TGAACGCATGTCCTCCGGAGAATCCGCCCGCACCGCCAGGGAAGCCTCCAGCACCTCCAG
CACCGCCAGGACCACCAGGACCAAAGCTTGGACCACCAGATCTAGCAGCCTCGAGACCGT
ATTGATCATATATTTCCCTTTTTTGAGGATCATTTAAAATTTCAAAGGCCTCTGATATCT
CCTTAAACTTTTCTGTGTCACCTGTTGGCTTATCTGGATGATATTTTAGAGCTGCTTTTC
TATAACCCTTTTTCAGTTCTTGCTCATTAGCACTTGGAGATACTCCAAGTAAATCATAAA
GTTTTGTCTCCTTGACCATTATTAGTTCTGTATACTATACTCTATTATATTGATGTGAAT
GTATTAAAAAAAAAATCTTAAAATGCAAACAACTTATCCTTTATCCTCTGAAGAGTTTCT
GGATGGTTATACAATTCTAAGTCGTTAAAAGAATTCGTGTAAGAGCTTAAATAATATTAA
TTAGAATTTTTGACAAGAAAGCGCATAAGTTTAAAAAGGGATTAACAATACGGTAAAGGG
ACGAGAAATCTATACAATATATATTAAATCTCGAACTACCTTGGCAAGGAGTTTGTGCTG
ACAGTGGTTGAAAAACCCGTAAAAGGATATCCCATTCTTTTTCCAGAAGTTTCTGGAACG
TTCATATAAACCAAAGAGGGTAACACAATACGTTAAGATTCAGAAAAGTAACGACTAGCT
ATTACTGATCATGTTATAGAAGAGTGCGACAACCATATATTATTAGCGCAGCGATCAACG
TGGCAGTCTTGTCATCCATATAAAAAAGGAGTTCTGATTG
Chr coordinates Chr XIV from 620067-620978
w3c xhtml validator w3c css validator