Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SIS1
Systematic Name YNL007C
Strain S288c
Description Type II HSP40 co-chaperone that interacts with the HSP70 protein Ssa1p; not functionally redundant with Ydj1p due to due to substrate specificity; shares similarity with bacterial DnaJ proteins
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SIS1 YNL007C
TAGATAAAGACTGGAGAGAGGTATCGTCCTCAGGTGTCAATTGATGGGTACACTGATTTT
CTCCTAAGTCCCAAATTCTTATATTACCATCTCTATCACAAGATATCAACTCGCCTTGGT
TAGGATGAATTACGACTTCATTTACTGGTGCGTTATGTTTGTAATTTCTAGGAATGGACG
GAGAACGCACATCCCAAACTTTAATGGTCCCATCTTCGCTAGAGGTCACCATCCATCTGT
TGTCCTGTTGAAAAGAAACGGAGGTAACGTTTCCCCGATGACCCTCAAAGGATGCTACTG
GATTGGGATTTGTCGTCCGAATGTCATAAAGCCGTACGTTTTGATGGCCTGCTGTTGCCA
ACAACTTTTTATCGTTGGTGATTTCTAAGCGATTAACCTGTGAGTCGGAATGCTGAATTG
TTCTTGAACAAACCCCAGTAAGAGCCTCCCAAAATCTTATTGTGTGGTCATAGCCAGCAG
ATACTAAGATAACAGACATCAATCAGAACTCCTTTTTTATATGGATGACAAGACTGCCAC
GTTGATCGCTGCGCTAATAATATATGGTTGTCGCACTCTTCTATAACATGATCAGTAATA
GCTAGTCGTTACTTTTCTGAATCTTAACGTATTGTGTTACCCTCTTTGGTTTATATGAAC
GTTCCAGAAACTTCTGGAAAAAGAATGGGATATCCTTTTACGGGTTTTTCAACCACTGTC
AGCACAAACTCCTTGCCAAGGTAGTTCGAGATTTAATATATATTGTATAGATTTCTCGTC
CCTTTACCGTATTGTTAATCCCTTTTTAAACTTATGCGCTTTCTTGTCAAAAATTCTAAT
TAATATTATTTAAGCTCTTACACGAATTCTTTTAACGACTTAGAATTGTATAACCATCCA
GAAACTCTTCAGAGGATAAAGGATAAGTTGTTTGCATTTTAAGATTTTTTTTTTAATACA
TTCACATCAATATAATAGAGTATAGTATACAGAACTAATA
Chr coordinates Chr XIV from 619565-618507
w3c xhtml validator w3c css validator