Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NCE103
Systematic Name YNL036W
Alias NCE3
Strain S288c
Description Carbonic anhydrase; poorly transcribed under aerobic conditions and at an undetectable level under anaerobic conditions; involved in non-classical protein export pathway
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NCE103 YNL036W
TATAGTTTCCCAGTCGATCGGGATATTTTCAGCCTCAAAAATGGTTCTCACTGAATCAGT
GATTTCTTTCCCAACACCGTCACCAGGTATCAAAGTGACGGTGAAACGACCGCCATACTT
CTTGGGTAGGGTGCGTTCCGCCTGAGCGGCAGTGGCTAAAGTTCTCTTAGCAATTGTTCT
GTTAAGCATTTTTCTCTTACAATTATGGAGGAAAAGGGAGAAGAATGAGGATAGGGAGAA
TAATGAACCTTGATTGTTACCAGTAATATTAAGGTACTGTTGAAATAGATCTACGGTAGA
GTAAAGAAATCAATCAATCAAGAATAAGCCAATGAAGCGGAAGAAAACAAGAAAAAAGAC
CTATGGAAAATATAGATAGTCCTATGTGCTCACCCACATAAAACACTTATATATATATTC
AGTGTAGGCATGTATTGTACGGGGATATATATATGAGGGTCTTCCTTTAATCGCTAAATA
ACAATACCGAGCTACCAAAAAAAATAAAAGAAGGTTTCTGCAATATGGTTGGTTGATGAG
TGACCTATGACGCCCGATGCTCGGAGAAGGTGGTCAGGCACACGTGATTCACCTAAACTC
GGCGCCGAAAAAAATTTGATCAGCCGTACAGTGTGATTGTTATCACGTGATAGTAACGTA
AGTCACGTGCTTTCTAACCATCACCCCGCACGAACGTTCGTTCCCGTTTCGATGTTGACG
TCAGAATGAGCTAACTTGACGCCACTGAATTAATTCGCATTGTCACCATGACGCTTATCA
AGCCGAAAAAATTACTAGTGATTCCTTCCTCCCCCTCTCTCGATGAGTAATTTTGAAATG
AACAAGTAGGCTGACATAGAGTACTATAAATACTTAGGAAGTAATGATTCTCGAGGATAG
GTAAGAGCTGTCCTCTTCTAATTCTTGTTCGTTTTCTTCTGAAAACCCCAACCACATCAA
CTACAGCTAAGACTACAAATTTCAATTATTACACATCAGA
Chr coordinates Chr XIV from 559814-560479
w3c xhtml validator w3c css validator