Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BOP3
Systematic Name YNL042W
Strain S288c
Description Protein of unknown function, potential Cdc28p substrate; overproduction confers resistance to methylmercury
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BOP3 YNL042W
GTGGTCTAGTGGTATGATTCTCGCTTTGGGCGACTTCCTGCCTAAACAGGAAGACAAAGC
ATGCGAGAGGCCCTGGGTTCAATTCCCAGCTCGCCCCGTTATCTTTTTTCACCATCAGGG
CGGAATTTTTTTGTTTAGCATCAATCAACCTAACCTCTCATGCTTCTCCAAGCTGAAAGA
AGTAAACTCACTCTATGTACGTGTTGCAACATATATCTGCCAAAAGAATGAAAGTAGGTT
CAGAACAAACAGATTGAAAGGAGACCAGTAAAACTATATGGGGGGGGTTGTTCTTCCCGC
CTCCTTCTGGGATTATGAAGACGCGCTGATCTGCTATAGTTCAACGTCCTTTTCGCTTAC
TATTTCTGGTAAGAAATATAAGGAATTCTCGGATTAATTACTTTTCTCGAAAGGGGATTC
CGAACACCTACCGGAAAAAAATAGCAGCCCTTAAGGGGAGAGTACGGCTCTTGGCATGAC
GGGAGGCAGGACAGCACTAAAGGCAGACTAGTCACTGAGCGCTCCAAGTTGGGTATGATA
GTATCTTCAAGTTTTGGTCGAGTAGCTATTCCTCTTCTTCAAAGCCACTTACGCTTCGCC
CAATAATGTCATGATTTACAAATAAACCTTCCTCTCCGAACCCTTAAAAGTAGGCAAATT
GAGAAAATTTTTTGCTCGTCTTTTTTTCTCTCGTTTCGATTACCTTATTGGGAACTTCTC
GAAGAACTCGGCGAAGAGGTCCAGAGGAAGATTACTGACTATCATCAAGCCTTGTTTCTT
TTGGCCTCTTCAGTAAGCTGCAAATGCAGTATTGGCTTTTTTAAAAAAGAAAAAGAGAAG
GAAAGCGGAAACTAGTCTTGTTGCTCTTCTAGTGCAGTTGTTGTTTGTTCATTTGTTTCT
TAATAACAGTCAACGAGAAAACTTGCGCGTGCAGTAGGAAAATAAGTAGCAAATTACATT
ACATGGAAAACTTGCAACCATCTGTGAGCACAGGCGACCA
Chr coordinates Chr XIV from 548100-549290
w3c xhtml validator w3c css validator