Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YIP3
Systematic Name YNL044W
Strain S288c
Description Protein localized to COPII vesicles; proposed to be involved in ER to Golgi transport; interacts with members of the Rab GTPase family and Yip1p; also interacts with Rtn1p
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YIP3 YNL044W
CTATTTCACTTGGAAACTATTTTGGGTGGTAAGGCTGAATTTGATCCATTTATTAGACAC
TATTTCAAGAAGTTTGCCAAAAAATCATTGGATACTTTCCAGTTTTTGGATACTTTGTAT
GAGTTCTATCCCGAAAAGAAAGAAATTTTGGATTCCGTTGACTGGGAAACTTGGCTGTAT
AAACCAGGTATGCCACCAAGGCCTCATTTTATTACGGCTTTGGCTGATAATGTTTATCAA
TTGGCTGACAAGTGGGTCGAAATGGCTCAACATTTGAAAACCACAGAGGATTTCCGGTCT
GAATTTAACGCTATTGACATTAAGGATTTTAATTCAAATCAATTGGTTTTGTTCTTGGAA
ACTTTGACACAAAATGGCCATTCCAACAAGAAACCAAAAGATTTTGACTGGGCCAAGTTT
CCCGTGGCATCTAGGGCACTGTTAGATATCTATCAAGATAACATTGTTAAATCACAGAAC
GCGGAAGTTGTTTTCAAGATGTTCAAATTTCAGATCTTTGCCAAGCTGCAAGAAGAATAT
AAGCATTTGGCCGATTGGTTGGGAACTGTAGGTAGAATGAAGTTTGTCCGTCCCGGTTAC
AGACTATTAAACTCTGTAGACCGTCGATTGGCACTTGCAACTTTCGACAAATTCAAGGAC
ACGTATCATCCAATCTGTAAAGCTCTTGTGAAACAAGATTTAGGTCTTTGAAAAGGGACG
TGTCGTAACATGAATACGTAAACAATTAAATATAACCTACTAATGAGCCTTCATTGCTAC
TTCTCTGGTTCTAATTAGTGGCGGAGTTCTGTGTCGTGCGATACGAATTTTGCACTTTTG
TCACATGCAATCGAGGCAAAAAGAAAAAATAAATAATAACAACGAATATAAATACAAATC
GAAAGAATTCAGATTGAATTCAATATTGCAGGGCTTTGAACACTGAGTTTGGAACTATCA
GCCGTCAAATACGCATAAAATAACATCAAATACTCCAATA
Chr coordinates Chr XIV from 545268-545291,545371-545877
w3c xhtml validator w3c css validator