Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SFB2
Systematic Name YNL049C
Alias ISS1
Strain S288c
Description Component of the Sec23p-Sfb2p heterodimer of the COPII vesicle coat, required for cargo selection during vesicle formation in ER to Golgi transport; homologous to Sec24p and Sfb3p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SFB2 YNL049C
ACATAAAAACTTTCCAGTATAATATTTTACCGTAAACTTTGATACCCTTCTTGGGCATTT
TGAACAGCTTATTTAACATGTCTTTTGACATTATCGGATAATGCGTATATGTGACGATAG
GAATTCTCCTCAAAAACCTAGCAATAATAGGATAGCTGAAAGGGTACCCCATTGTATCAA
TCCATATATCAGGTGGACACTGAATAATGGATTCAAATGCGAGAATCATTGATCCAATTG
CTTGTCCAATCAACGTGAAATGCTTCCATGTTGAAGAATCCACCAAGTATCTTAGCTTCA
ATGAAATGAAAAATATTCTATCCGAATCCAAGTCGTAATCGAACTTCGCTTTCACATTAT
TTAGAATATTCTCCGGAGTAACATTCTCTCCATTCACAAAATCCCCTGAATAAATGACAA
TAACGTTCTTAGCATCTTTTCTCAAAGTGATATCTACAGCTTTCCAGAGCACTTTTTCCC
CACCACCACCAGCATTACAATACGGATGAAAAAAACCAAAAACTTTCACATTCTTCTCAC
CACAGGAGGCAACTGCTCTGTTCAGTAATGAAGATTTTTTGGAGAACGGATTCAAGCTGG
AATACACCCATTGACGGAAGATCCACGTGAGAACCTTAATTAGTCCATACACTAGTACTA
AAGATGATACAACATATTTTTTGAACCCAAAATGAGACTTAACCTCTTCAAAATTGTAGT
TTGTCCAAGCACTGCCCATTTTCGCCTGCAATCACCTGAACATGTTGGTCACACTTGGAT
ACTAACATCTATCTTCACTTCACTTACCTCTCAATCTTATTATTTATTGAACTTTTCACT
TTTTGTTTAGCTTACCCGAAGGACATAGATGTAGCGATGACAACGATGAATGATACGTCA
GTTAAAAGGGTCTTCGTCGAACTCTTCATCTAACCCTTCATTTGCAGTGTGCTTGGTTGA
TGAACCTTCTTCCATTAATGATCGACAGCTGCAGTGAATA
Chr coordinates Chr XIV from 537911-535281
w3c xhtml validator w3c css validator