Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name POR1
Systematic Name YNL055C
Alias OMP2, porin POR1, VDAC, YVDAC1
Strain S288c
Description Mitochondrial porin (voltage-dependent anion channel), outer membrane protein required for the maintenance of mitochondrial osmotic stability and mitochondrial membrane permeability; phosphorylated
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>POR1 YNL055C
AAACTGTGAATGTGGCCCAGGTGGAAAGTACATAGGCGACATTTGATAAGGTGTATACGG
AATCATAGATGGGCGTCCGTAAAATGACCAATCAGATGGATTGGCTTGGTTTTGGGTCAT
CATGCACTGCTGTGGGTACGGCCCATTCTGTGGTGAATGTGACTGAGCAGTTTGAGGAGA
GGCATGATGGGGGTTCTCTGGAACAGCTGATGAAGCAGGTGTTGTTGTCTGTTGAGAGTT
AGCCTTAGTGGAAGCCTTATCATATTCTTGAATTTTGGAAGCTGAAACGTCTAACGGATC
TTGATTTGTGTGGACTTCCTTAGAAGTAACCGAAGCACAGGCGCTACCATGAGAAATGGG
TGAATGTTGAGATAATTGTTGGGATTCCATTGTTGATAAAGGCTATAATATTAGGTATAC
AGAATATACTAGAAGTTCTCCTCGAGGATTTAGGAATCCATAAAAGGAAATCTGTAATTC
TACACAATTCTATAAATATTATTATCATCGTTTTATATGTTAATATTCATTGATCCTATT
ACATTATCAATCCTTGCGTTTCAGCTTCCACTAATTTAGATGACTATTTCTCATCATTTG
CGTCATCTTCTAACACCGTATATGATAATATACTAGTAACGTAAATACTAGTTAGTAGAT
GATAGTTGATTTTTATTCCAACAAGTTTAATGGTCAGAATGGGCGCTTGTCGCGTGCCAG
ATCGGGGTTCAATTCCCCGTCGCGGAGATTTTTTGCCGCACGTTTCCGCGTCAGACGAGC
TTTTTTCACGGTTCCGGTGCTTTTTGCCGGCTGCGGCCCAATCAAACACCGCCATTTCGG
CCGTTCCTCAACAAAGAACCCCTTTTATAGCCAGCAGAGCACGAGTTGATCTACTATATA
ACTACCCCCAACTCGTTCCACTACTCATTAGTGCTACGGATTCTCCCAACACGAAACAGC
CAAGCGTACCCAAAGCAAAAATCAAACCAACCTCTCAACA
Chr coordinates Chr XIV from 518845-517994
w3c xhtml validator w3c css validator