Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YDJ1
Systematic Name YNL064C
Alias HSP40, MAB3, MAS5
Strain S288c
Description Type I HSP40 co-chaperone involved in regulation of the HSP90 and HSP70 functions; involved in protein translocation across membranes; member of the DnaJ family
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YDJ1 YNL064C
TATGCAGTGGTATAGTATGCCTTGAAAGCATAGAGTTGTTTAGAGCTCTTATTATGGCCA
TCACCCATTCCTCGGTTTCCCATCTTGGTATAAGAACACCAGGCTTGCAAACTATGTCCA
AGGCCCCAAACGGTTGCGATCTTAAGATGTACTGCAATGGGACGTGTTTGTATCTCTGTA
AGCAAGCCCAGCGGATTGATTTATCCGGAGGCAGCTCTTCGGTGAGCCATTTGTACTCGA
GTTTCGCTTGCTCGAGAGTCCTACATTCTGGAAGCAAAAGATGCAAACCAGGTCGTATTC
TCGAAGCTTTTCTTATCAATGATGTAGATATTCGAGGCATATGTTCTTTCTAACCGTTTC
TTTTTCGTTCCTACCATTCAACTATCGCTCCTTGTCTACGAGTTAAGGGGAAGAGAGTGC
AGAGTTTCTAAAAGCACTTGAAAACGTAACAAGACATTGACCGTAGAGAGTCGGCAAAAT
AAAGTCGTTTATACACGTTTGAGTTGTGTGTATTCAACTATGGAATACATTGTTATAATG
AGTATGTTGGTATAAAATAAGATGTGAAGTCGCTGGTTTGAGCACGTGATATACACCTGA
CCTATAATATTTCGTACAAAATTATAGAAGGCCATCGAAAAAATAGAAAATTTTTTCATT
TCTTTTTCAAGAAATGAAAAGGCAATAGAGCATCGGCAGGTATGGAAAGTATTTAACTTG
CAGATCAATCCACGTACTTATAAAACGTGTAAAAACTTGCTCTACGTTTATATGTTGGTT
AGGTAGTTCTTGTTTGATAAGGTGTGTAGTTCGTTTTTATAAATCAAAGTCACAAAAAGT
CCTTTTCCCCATATATATTAGGCCCGAACAAGCGTCTTATTTGATAACTGTTACGTATTT
ATTTTTTTGTTATTTGTTACCATATCTTTTGATAGAACATAATTAAAAATTATCCAAACT
GAATTCTACATCTTCCAACAACAATAATAAACGTCCAAAG
Chr coordinates Chr XIV from 507097-505868
w3c xhtml validator w3c css validator