Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YNL067W-B
Systematic Name YNL067W-B
Alias YNL067W-A
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YNL067W-B YNL067W-B
CTTTGAAGTGTTTTTAGCCTTTTGTTCCTTAGTATGATCTTGATTATTGAGCGGTTCAAT
TCAGTGGAAAAGGACTGCTCTATAGTGTTTTAAGTTTTACAGAAATATAGTGATCCTATG
AATGTCACTTTTTTGTTTACCTTTAGAAATGCGGAACCATTGGCATTTTTTTTCTTTATT
TACTAATTTACCTAGAAAATCCAAATGGCACAGGGCGAGCGAATTTTTTTTCCCTCTTTT
AATGAGCGAAATCGAAGATTTTCGGTAATGTTGTGCGAAGGGTTCTGGGGCGGGGTCCGG
CATAAGTCATCATCAATGCTAAGGGAACGATTATATGGCACAGAAAGAGACAGGAAGAAG
AGGCCATCAAAATGTTGCAGCTTAAGGGATAAGCATAAAGCGTAATCAATAAAAAACAGC
CTGTACCCAACAGGCAGCAAATTTTTGAAAGCCTGTTGCAAGATACATATGACACAAATT
ATTAAAATATGTTGAATTAATATTCAGTTCTTACAGTTGACATGATCCGACTCAAATGTT
AATGTTCTTGAGGTTCTATAGTTTCAAAATAGCTTTTTACTTTCTGCTATTGGACCCTTT
TGGACCAGCCGAAGGAAGTTTTTTTTCTTTATGTTTAGCTCTTTTTTCATCACTTCTAAT
TCGCAAATAGAAGGGGAAGGAGGACAGCAATTATGTAAAAATTAATTAGTATGTCAGTAA
CAAAAAGAAGAGATAACAGAGGTAGTTCCTCTAGACATTTTTAAGACGACTATTGATGCC
AGGCAAATTTTGGATTTACTGCTCCTCTTTTAAGAAGACAAGTGTGTGATATCGTAGCGG
TAGGAACCAATTTTGCAATCGATTTACTTACAGCCAAGAAAATCTATTTTCATGTTTAGC
ATTGCCATTTCTTCTGTGTCACACGTTGTGCTTGCCAGGAACTATAGGAGAGACGTATAC
AAGCATCAATGTTACGAATGTACGATCCCGTTTGCATCTG
Chr coordinates Chr XIV from 499417-499557
w3c xhtml validator w3c css validator