Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TPM1
Systematic Name YNL079C
Strain S288c
Description Major isoform of tropomyosin; binds to and stabilizes actin cables and filaments, which direct polarized cell growth and the distribution of several organelles; acetylated by the NatB complex and acetylated form binds actin most efficiently
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TPM1 YNL079C
ATTGGCTTTGCGTTTATGGTAGGAGAGCGAGACCTCATCTTATAATTCGACCATTGCGTA
AACTGTTCCATCACTTCAGTGCTTTCAACCTGGTCCGCTTTGCTTATGTTACGGTTCCTC
AAGTGCGAAGCATCGTGGTACTCCATATATGGTTTGAAGCTGTCGTGTGTTATATGAGAG
TCATCCGATATTTGCACTATAGGAATCTTGGTATCTGAATTTGAATTTGTGTTCGAATTT
GTGTTCGAATTTGTGTTCGAGTTCGAGTTCGAGTTCGATGTAGAATCCACAAGCGCATGT
ATATAACCTGAAGTGGTAAACCCACCGGTACCCAGGGGAGGTGGGAACAAAGTCGGGGGA
TAAGACTGAGTCCCAATGCTAGTCTCGTATGTCTCCATTGTCTGTATGGTTGTATTTCAA
GACGTATCTGCAAGAAAACTGATGTTTGCGAGTTAGGAACAGGGAAAAATACATGAATTA
AGAAATACGAACGATCTTAACTATTTTCAACAGTACCTGAAACATGGATGTAAAAACGTA
GAAGATACCCGAATAAAGTGGGGCGCACACCGGACTTGAAACCACTCCTCCTTTACCAAG
CACTAATTTAAGCTAATCTAATTTAACGCAGTACATTTTGTATGCGCGGCAGCAGCTTAA
TACATTGCTGTCATTCACTAATGGAAAAAAAAAAAAAAAAAAAAAATCAAAATATAAAAA
TAAATATTAAGAACTTAAAAAGACAAACCAGCCATCGCGTGGCGCTAGCACATATATCTT
ACCCGACGGAGAGCCGGGTAAAGAAGTCGGGTAACCATTAAAATAAAAAATCAGCACACC
ATAGCACGATCTACGAGAAACGGAAAAGTGTTAGAGATCACATACTGCATACTTGGCAAG
AAGAAGGTTCGTTTTTCCCTTCTGATACTGTAAAAGATTAGGTTGGTAGAAGAAATCTAC
ATAGTAGAACTCACACCCCATACACACAAAAAAGGCAACA
Chr coordinates Chr XIV from 479165-478566
w3c xhtml validator w3c css validator