Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name END3
Systematic Name YNL084C
Strain S288c
Description EH domain-containing protein involved in endocytosis; actin cytoskeletal organization and cell wall morphogenesis; forms a complex with Sla1p and Pan1p
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>END3 YNL084C
CCTTGAAATAACACCTGAAATACCACCAGCAATAAAAAACCCGAACCCGCGAATGAAATC
GTTTATGAGAGTAACATCTCCCTCTGAGGACAGATCGACATCTTCGTTGAATAGGTAAAA
ATAGGAATAAGCAGTATGAAGTCTCGAACCCTGCTTTCTCGGTACCAGCAGCAAAAAGTC
TCTCCATTGATCATATGTAACGTATAAATCTGAGTCGGTGGTTTTCTTTGACCGATCATT
ATCAGTATTCTTTTTGTGGCTAGCCTGGCCTCGTAGCGCAATGTTGGCTTTTCTCTTTGG
AAACGCCCATTCAAAAAACCTCGAGAATTTGTTCATCTTTTCATTTGAAAGTTCATGATT
AAGTTCATTATTACATATGCTCTGGTTGTCGAGGTCTGACAAATACCTATTTATTTCGTT
AATGCCAATCTTACCGTCATGATCTAAATCTATCCTCTGGAAGCCGTTCCAAATTTGAGA
TTCGGCATTGGAAGCATACTTCTTGAAATCGCTTAAATCAACTACAGAGTCCTTGTTAAC
ATCCATTGCAGTAAACAGCATTTTGATTGCCTCATCATTTCCCTTGAGCGGATGGTCGTT
CTTCTCAAAAGCACTTATCAGATTATCTAGAGTAACTTGACCATTTCCCTTAACATCAAG
TTCCTTGAACAAACACGCATACCGTATATCTCGCTGCTTGTCCGTCTCGCAATTTTTCAG
CAGCATTTAGACCGTCATTCGATTGAATTAAACGTTATTTGCCCCTTCAAATATTCAATA
TTTCCCATCGCTAATAAAAAAGCTGCATTTTTATTTATTACTTTTTAAATATCATATTTG
ACGATCGTGTAGGACCCCTATGATTTAACATATCAAGAATGAATGAAAAGAACGTCAGAA
ACACAAGGTTAATTGCCTGTTATAATCAGACGATTGTAATATAACCATAGAGTTAGTGGG
TATTGGAAAGGCCGGTAAAGATAACAGGGATCTCTGAAAA
Chr coordinates Chr XIV from 471102-470053
w3c xhtml validator w3c css validator