Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RHO2
Systematic Name YNL090W
Strain S288c
Description Non-essential small GTPase of the Rho/Rac family of Ras-like proteins; involved in the establishment of cell polarity and in microtubule assembly
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RHO2 YNL090W
ATCGAACTTCTATCTGGGACAGCAGCACCACTCCGATGATGAATAAATCCGAGCTTTCCG
GTCGCAATATAACTAGTACTGCGCAAGATAGCCCTGCGTTCATGGCATCAAATATCTGGT
CTAGTAACAGTCAATACAATTCACCATATTTGACTAGCAACGTCCTTCAATCCCCTCAAA
TTTCGAGTGGAGTGGATGAAAGCCACATTCTGGATAGCATCTACAATACTTATTTAGCTA
TTTCCCCACAAGATAGTTTAAACCCCTACATTGCTATCGGGACACTATTCCAAAATTTAG
TAGGACTTAACTTGGATTACTCGACGTTTATCAACAAATTGATAAGCATGCAAGGAGCCT
ACAATTGCGAATTCTTTACTGATAACAATGGATCCATTACCCACGTTCGATTTGCGAGAC
AAACTCCCGCTGGCCACTCAAAGGGGTTGCTGAATCAACTCTTTAGTGGATTGAACGATC
CAACTGCTACACCATTTACGTCAAGGCCTCATACCTCCACAAGGGCTAGTTTTCCAATTG
CCTCTTCAACTACGCAAACGTCTTAAATTTGCTCCGGTACGCAGGGCCAAAAATATTTAC
ATACATACATAATTCGACGAAATTTCAGAAGAGACACTAAACAATCGTACATCTCTCTAC
TCGATGTGAGCCACGCGTCGGTTTTTCTTACCGTCGTGGCTTTAGAGGTGAGGCTGCGAC
ACCCCATACATCTTACCCGGCATTTAATTTCCATTTTTCGCAGGAATGTGAATATGATAA
TAGACTTCGGTACACTCTTTTTTAGGTATAACATATATCAATTGTTCAACAACAATTATT
CAAAGCGCAACTCTCCAAAGGTAGTTATTCTGATAATTTGAACCAAAAGTCCCCAGATTA
AGTCTTAATTAAACTGCCCTTGCATACCGCTGTAAACGATTTGTGTGCAGACATCAATTG
CTGAAACGTTCTGCTTTGGTTGTGCTTTTGATCCCGTACT
Chr coordinates Chr XIV from 456565-457143
w3c xhtml validator w3c css validator