Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name APP1
Systematic Name YNL094W
Strain S288c
Description Protein of unknown function, interacts with Rvs161p and Rvs167p; computational analysis of protein-protein interactions in large-scale studies suggests a possible role in actin filament organization
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>APP1 YNL094W
CAGATAATTCCCACAGATTTGATGTCTTTATCTTCAATATTAGCGACAATCTTGTTGAAT
GACAGAGAGGGTAGTAAAACTGTTAGCACGATATCAGAAATAATTCTTGTTGCTTCAACC
GTAAGAATTCCCATTTTAGCCATCAGAAAGCCGACTCCTATAATCAAATAAATCTTGATT
ATCGGCTTAACTGACACCCATATCGCTTGACCCAGAGTAATGTGCACCATCTGATGAAAA
TTTGAGGTTTCAATCCCTTTCTCTGTTTGATTCTATAACTTCTCCAAAAAAATTGCGCTG
ACGCTAATTAGTCACTGTTTATATCTTTTTTAGCGATGATTTGTAACAATATGCCATAAA
AGCGTTCTCTAACTGCGGAAGTGATGAGAATTGAATAGTTTTATTCAGAAGGCAATATAT
CCTAATATGGCACAAAAAGGCAACTTGTATGCACAAAATGAGCATAAGAGTTCAGGCAGA
ACGTTGTGCTCTTGATCCAAAGGTTAAAAGTCATCGAGTAGGAAGATATTGTAACCTTCG
CGCAAACCGCAGCCGCAGCGGGTCACGTGGTCGCGCAAATGATGATGAGGGCGCGGTCTA
ACTTTCCAAACGAGGTTACCAACAATTCTCGGACAGATAAAGCATTAGAATAGGGTGGCA
ACGCCTTTACGGTTAGCTTGTTCATTGTGATTGGTTTGTGTATCTTTTCTTGGCTTTTTA
TGCCCACGAGACATAAAGTATACGAAGCTGTTATACTATTCGTGATCCAGGGCAAAAATT
TAGCATCATTAAGGCATATATATCGCAAATAGTGGGTTGCACAAGGCTTTCAATAAACAG
TGTCATATGTTTCTCTAGCTCTGTCGGTTTGTTGGCTATAAAGAGTTTGTCTAGTAATCG
CCGTCTTTTCTTGGGACCATTAACACAGACAAGGACATTGAAACTTGGCTATAAGTTCCG
TCAAAGGGGGAAAAAATTGCTTTGGAGAAGGAATAAAAAG
Chr coordinates Chr XIV from 447611-449374
w3c xhtml validator w3c css validator