Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPS7B
Systematic Name YNL096C
Alias eS7, rp30, S7B, S7e
Strain S288c
Description Protein component of the small (40S) ribosomal subunit, nearly identical to Rps7Ap; interacts with Kti11p; deletion causes hypersensitivity to zymocin; has similarity to rat S7 and Xenopus S8 ribosomal proteins
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS7B YNL096C
GTGCCGCATGTGTTCCATTTGGGTTGATATTATTAGGAGCAACTTTAGGAAGATTAAAGA
TTGGCAACCTTTATCCTGGATTTTGGAAAGCCGCTGTGACACTCGTCATTTTGAGACAAT
GTGTCATGCCAATTTTTGGTGTCCTATGGTGTGATCGGTTAGTGAAAGCTGGATGGGTTA
ATTGGCAAGATGATAGAATGCTACTATTTGTTATAGCAATCAGCTGGAACTTGCCAACGA
TGACTACCCTTATATATTTCACCGCCAGTTTTACGCCGCCAGAAACAACTGCGCCAATCC
AAATGGAGTGTGTTTCATTTTTCTTAATGCTGCAATACCCGCTAATGGTTGTTAGCTTGC
CATTTTTAGTGTCTTACTTTCTGAAAGTACAGATGAACCTTTAGTTTTAATCCATTAAAC
AAAAAATTATTACCACTCCTAATCACTGTTTTAGGGTGGGTTAAAATTAACATTCTCCAT
TTTTATATAGAACTAATAAAAAACACCTACTTATAGACACGACCAAACTTTCCACAACCT
TTCATCAGAGAGAAATGTTGATCAAGTTGAATGCGTGAAAGTAGCAATTCGAAACAACAA
CTACCTGTCATTCTGCATAGTAGTAGTTACGAAAGGCACAGAAAATAACAAAAAAAAAAA
AAAAGTCAATTTTCTACGGTCTCCATCCGTACCTCTTTAAATCCGTACATTATTGTTTTG
CTTAATTTCAATATTTCGGAAAAAGCGAGCGCCCTGGTAAAATGTGGTTCAAGCCTGCGA
GCCTTTGCTTGGTAACTCACCAAATGCAATTCAGTCACGTTCCACACAGTTTGGGTTTCC
AGCCTGGCTTTAGGGAAGAATGGGCTCACTAGGCGTTCATAATACGCGGAGGGGGAAATA
CCAAATGCTATTGATTATGGTTAAAATATGTGTTATTTGACTTTGTATATACAAACAGAA
GAGAAACCAACACACTAAAGACTAGACACATAACTGACCA
Chr coordinates Chr XIV from 443826-443398,444315-444172
w3c xhtml validator w3c css validator