Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MIC27
Systematic Name YNL100W
Alias AIM37, MCS27
Strain S288c
Description Putative protein of unknown function; non-tagged protein is detected in purified mitochondria; null mutant is viable and displays reduced respiratory growth and reduced frequency of mitochondrial genome loss
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MIC27 YNL100W
GCATACGGCTCAAATGTTCAAACGGTTATACTGTTGAACTTACCTCAAAGTAACATTTTT
GTAAACTTAATCCAGCTGTTCTATTCCATCGCAATTATGTTGTCCACACCTTTGCAGTTG
TTTCCAGCTATTAAAATTATTGAAAATAAGTTTTTTCCAAAGTTCACTAAAATATATGTC
AAGCACGATGATCTAACAACAAGAGTCGAATTACGTCCTAATTCAGGAAAGCTGAACTGG
AAAATTAAATGGCTGAAGAACTTTATTCGTTCTATAATCGTAATCATTGTTGTATCAATT
GCTTACTTTGGGTCTGATAATTTAGACAAGTTCGTTTCAGTTATAGGATCCCTCGCCTGT
ATTCCTTTGGTATATATATACCCATCGATGCTGCATTTACGGGGCAATAGCCTTCCAGAG
ACTAAAGGGGAATTTTGGAGATTCAAACCAATGTTAGATACCATTTTAATTTTCTTCGGT
ATTGCAAGCATGCTTTATACGTCTTACCAGAGTATATTCGGTGTCTAGACGATATATGTT
GTTGCTTCATAAAGAATTTATTTGGAATCGAGGAACACTATTTTGCCATTGTCGCCATTG
ACAGCTTGCAGTTGCAAACGTCTTCTTAATTCACTTTATATAAACAAGGACCGCCAGGTC
ACAGTATTATTCGCACGAAATTATGTAGTAGGTAAAAAACACTAAAAGCATTACCCCTAT
ATTGTTATTTAATGTTCCATCTACGATTAGTAGGTGGTGAGCATGTCTGAATATACACAA
TTTCATATTTATTATCAAGTTCAAGATTGCCAGAATTTTATTTTTTTTTCCAATCTGCGA
ATAAGCTTGATCCGATTACTCCGCTTAATGCCCCGACAACCTGAGAACTTTTAAACATAT
CAAGGAGTAGAGTGGGATTAATGACAATGTGATAGTTTCATAATTAAAGTAAGCAGTCAA
AGACAGAAGCAGCACACCATTTACCAATACAGCTTCCAAA
Chr coordinates Chr XIV from 437613-438317
w3c xhtml validator w3c css validator